IthaID: 3579



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs3115229 HGVS Name: NC_000004.12:g.122088578T>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CAGAGGGTGAAGGGCAAGTTTTCCC [T>C] TTGCCCTACAGTAGAAATTAATAAA (Strand: +)

Comments: SNP associated with acute, severe vaso-occlusive pain requiring hospitalization among pediatric patients with SCA (n=1293 participants in the SIT trial and CSSCD). SNP is located 63.7 kb 5' upstream of the KIAA1109 gene.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Vaso-occlusive crisis

Location

Chromosome: 4
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: TRPC3-KIAA1109
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Chaturvedi S, Bhatnagar P, Bean CJ, Steinberg MH, Milton JN, Casella JF, Barron-Casella E, Arking DE, DeBaun MR, Genome-wide association study to identify variants associated with acute severe vaso-occlusive pain in sickle cell anemia., Blood, 130(5), 686-688, 2017 PubMed
Created on 2020-03-25 15:47:40, Last reviewed on 2020-03-25 20:27:04 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.