IthaID: 3709

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs75853687	HGVS Name:	NC_000005.10:g.159850278G>A

Context nucleotide sequence:
GGGTTTCAGGGCTTGGGCAAGC [G>A] TGAGTGATTCGCACTCTGGCAGG (Strand: +)

Also known as:

Comments: Allele 'A' associated with an increased susceptibility to develop alloantibodies in transfused sickle cell disease (SCD) patients of African ancestry. Nominally replicated in an independent cohort of SCD transfusion recipients. Located in an enhancer region embedded within the lncRNA gene LINC01847 and is near binding sites for multiple transcription factors and enhancer binding proteins, such as CEBPB (pro-inflammatory function).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Red blood cell alloimmunisation

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	5
Locus:	NR_109891.1
Locus Location:	N/A
Size:	1 bp
Located at:	LINC01847
Specific Location:	Intron 2

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African American
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Williams LM, Qi Z, Batai K, Hooker S, Hall NJ, Machado RF, Chen A, Campbell-Lee S, Guan Y, Kittles R, Hanchard NA, A locus on chromosome 5 shows African ancestry-limited association with alloimmunization in sickle cell disease., Blood Adv, 2(24), 3637-3647, 2018 PubMed

Created on 2020-12-09 14:00:07, Last reviewed on 2020-12-09 14:00:41 (Show full history)

A/A	Date	Curator(s)	Comments
1	2020-12-09 14:00:07	The IthaGenes Curation Team	Created
2	2020-12-09 14:00:41	The IthaGenes Curation Team	Reviewed. Comment added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.