IthaID: 3730

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: IVS I-73 G>A HGVS Name: HBA2:c.96-45G>A
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCACAGGCCACCCTCAACCGTCCT [G/A] GCCCCGGACCCAAACCCCACCCCT (Strand: +)

Comments: Reported in 1 case in cis with -α3.7 [IthaID: 300] and compound heterozygosity with Poly A (AATAAA>AATA--) [IthaID: 425].Clinically presented with Hb 12.6 g/dL and reduced level of MCV 61.4 fL and MCH 18.8 pg.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33943
Size: 1 bp
Located at: α2
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Mohd Yasin, Norafiza 2020-11-24First report.
Created on 2021-02-10 07:48:06, Last reviewed on 2021-05-14 15:41:55 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.