
IthaID: 3784
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign | 
|---|---|---|---|
| Common Name: | CD 133 GTG>GTC [Val>Val] | HGVS Name: | HBB:c.402G>C | 
We follow the 
						 
							HGVS sequence variant nomenclature
						
						and
						 
							 IUPAC standards.
						
					
					
					
Context nucleotide sequence:
AGTGCAGGCTGCCTATCAGAAAGT [G/C] GTGGCTGGTGTGGCTAATGCCCTG  (Strand: -)
Comments: Variation is reported in ClinVar as Conflicting interpretations of pathogenicity Benign(1);Likely benign(3);Uncertain significance(4) with an 1-star review status (criteria provided, conflicting interpretations).
Phenotype
| Allele Phenotype: | Neutral | 
|---|---|
| Associated Phenotypes: | N/A | 
Location
| Chromosome: | 11 | 
|---|---|
| Locus: | NG_000007.3 | 
| Locus Location: | 71976 | 
| Size: | 1 bp | 
| Located at: | β | 
| Specific Location: | Exon 3 | 
Other details
| Type of Mutation: | Point-Mutation(Substitution) | 
|---|---|
| Effect on Gene/Protein Function: | Splice junction (mRNA Processing), Missense codons (Protein Structure) | 
| Ethnic Origin: | N/A | 
| Molecular mechanism: | N/A | 
| Inheritance: | Recessive | 
| DNA Sequence Determined: | Yes | 
In silico pathogenicity prediction
Publications / Origin
- Pianezze G, Toniolo M, Taddei Masieri M, Dolcini B, Ravani A, Hb Belluno [β111(G13)Val→Gly;β133(H11)Val→Val (HBB: c.335T > G;402G > C)]: Incidental Detection of a New Clinically Silent β Chain Variant During Hb A1c Determination by High Performance Liquid Chromatography., Hemoglobin , 40(3), 143-9, 2016
- Carlice-Dos-Reis T, Viana J, Moreira FC, Cardoso GL, Guerreiro J, Santos S, Ribeiro-Dos-Santos Â, Investigation of mutations in the HBB gene using the 1,000 genomes database., PLoS One, 12(4), e0174637, 2017
					Created on 2021-04-05 13:01:33,
					Last reviewed on 2025-02-12 09:24:43					(Show full history)
				
				
			
 Disclaimer: The information on this website is provided as an information resource only
    and must not to be used as a substitute for professional diagnosis and treatment.
    The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
    diagnosis or any other information, services or products that an individual obtains through this website.