
IthaID: 3790
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -125 C>T | HGVS Name: | HBG2:c.-177C>T |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TCCACCCATGGGTTGGCCAGCC [C/T] TGCCTTGACCAATAGCCTTGACA (Strand: -)
Comments: Found in a 26-year-old Chinese male presented with decreased levels of Hb 12.1 g/dL, MCV 70.0 fL, MCH 23.0 pg, and normal levels of RBC 5.26×1012/L and MCHC 329 g/L. Capillary electrophoresis shown abnormal hemoglobin electrophoresis results with elevated level of Hb F 87.9%, reduced level of Hb A 9.7% and normal level of Hb A2 2.4%. The patient was a β-thalassemia intermedia because of compound heterozygosity of CD 41/42 (-CTTT) [IthaID:147] and -28 (A>G) [IthaID:29] in HBB. He did not show anemia and is speculated that the -124 C>T in HBG2 may have alleviated the symptoms.
External Links
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 42710 |
| Size: | 1 bp |
| Located at: | Gγ |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Li, Youqiong | 2021-05-20 | First report. |