IthaID: 3790


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -125 C>T HGVS Name: HBG2:c.-177C>T
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TCCACCCATGGGTTGGCCAGCC [C/T] TGCCTTGACCAATAGCCTTGACA (Strand: -)

Also known as:

Comments: Found in a 26-year-old Chinese male presented with decreased levels of Hb 12.1 g/dL, MCV 70.0 fL, MCH 23.0 pg, and normal levels of RBC 5.26×1012/L and MCHC 329 g/L. Capillary electrophoresis shown abnormal hemoglobin electrophoresis results with elevated level of Hb F 87.9%, reduced level of Hb A 9.7% and normal level of Hb A2 2.4%. The patient was a β-thalassemia intermedia because of compound heterozygosity of CD 41/42 (-CTTT) [IthaID:147] and -28 (A>G) [IthaID:29] in HBB. He did not show anemia and is speculated that the -124 C>T in HBG2 may have alleviated the symptoms.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 42710
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Li, Youqiong2021-05-20First report.
Created on 2021-05-21 16:06:18, Last reviewed on 2022-01-20 11:20:11 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.