
IthaID: 3815
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs2070973 | HGVS Name: | NG_000007.3:g.43439A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGTTTGAAGATACTGGGGTTGGG [A>G] GTGAAGAAACTGCAGAGGACTAA (Strand: -)
Comments: Associated with disease severity in Thai individuals with β0-thalassaemia/HbE.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Severity [HP:0012824] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 43439 |
| Size: | 1 bp |
| Located at: | Gγ |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
Created on 2021-07-09 14:43:07,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.