IthaID: 3859

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs7569946	HGVS Name:	NC_000002.12:g.60460824A>G

Context nucleotide sequence:
CCCGGGCGGTGTGGAGAAGCGCAA [A>G] CTCCCGTTCTCCGAGGAGTGCTCCGA (Strand: +)

Protein sequence:
MSRRKQGKPQHLSKREFSPEPLEAILTDDEPDHGPLGAPEGDHDLLTCGQCQMNFPLGDILIFIEHKRKQCNGSLCLEKAVDKPPSPSPIEMKKASNPVEVGIQVTPEDDDCLSTSSRGICPKQEHIADKLLHWRGLSSPRSAHGALIPTPGMSAEYAPQGICKDEPSSYTCTTCKQPFTSAWFLLQHAQNTHGLRIYLESEHGSPLTPRVGIPSGLGAECPSQPPLHGIHIADNNPFNLLRIPGSVSREASGLAEGRFPPTPPLFSPPPRHHLDPHRIERLGAEEMALATHHPSAFDRVLRLNPMAMEPPAMDFSRRLRELAGNTSSPPLSPGRPSPMQRLLQPFQPGSKPPFLATPPLPPLQSAPPPSQPPVKSKSCEFCGKTFKFQSNLVVHRRSHTGEKPYKCNLCDHACTQASKLKRHMKTHMHKSSPMTVKSDDGLSTASSPEPGTSDLVGSASSALKSVVAKFKSENDPNLIPENGDEEEEEDDEEEEEEEEEEEEELTESERVDYGFGLSLEAARHHENSSRGAVVGVGDESRALPDVMQGMVLSSMQHFSEAFHQVLGEKHKRGHLAEAEGHRDTCDEDSVAGESDRIDDGTVNGRGCSPGESASGGLSKKLLLGSPSSLSPFSKRIKLEKEFDLPPAAMPNTENVYSQWLAGYAASRQLKDPFLSFGDSRQSPFASSSEHSSENGSLRFSTPPGELDGGISGRSGTGSGGSTPHISGPGPGRPSSKEGRRSDTCEYCGKVFKNCSNLTVHRRSHTGERPYKCELCNYACAQSSKLTRHMKTHGQVGKDVYKCEICKMPFSVYSTLEKHMKKWHSDRVLNNDIKTE

Also known as:

Comments: The A allele associated with HbF in the high-HbF (>30%) subgroup of Kuwaiti patients with sickle cell disease.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Hb F levels [HP:0011904] [OMIM:141749]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	2
Locus:	NG_011968.1
Locus Location:	97675
Size:	1 bp
Located at:	BCL11A
Specific Location:	Exon 4

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Missense codons (Protein Structure)
Ethnic Origin:	Kuwaiti
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021 PubMed

Created on 2021-09-23 16:20:36, Last reviewed on 2021-09-23 16:27:17 (Show full history)

A/A	Date	Curator(s)	Comments
1	2021-09-23 16:20:36	The IthaGenes Curation Team	Created
2	2021-09-23 16:27:17	The IthaGenes Curation Team	Reviewed. Protein info.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.