IthaID: 3887

Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: N/A
Common Name: -365 G>C HGVS Name: HBG1:c.-417G>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTACAGGCCTCACTGGAGCTA [G/C] AGACAAGAAGGTAAAAAACGG (Strand: -)

Comments: Found in a 63-year-old female in association with Hb G-San José [IthaID:830] and Gγ -158 C>T [IthaID:2127], presented with Hb 11.1 g/dL, RBC 4.26×1012/L, MCV 82.5 fL and MCH 26.1 pg. Capillary electrophoresis shown HbA 73%, HbA2 3.4% and HbF+Hb G-San José 23.6%.

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47394
Size: 1 bp
Located at: Aγ
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Li, Youqiong2022-01-05First report.
Created on 2022-01-20 11:23:39, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.