IthaID: 3895



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2073617 HGVS Name: NC_000008.11:g.118952044G>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGGGGGTGTGCAGAAAGCTCCAGG [G>A] TTAACGCTTTCAGGGCTGGGGCGG (Strand: +)

Comments: Reported in pediatric beta-thalassemia patients with a higher incidence in those with low spine bone mineral density.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Reduced bone mineral density [HP:0004349]

Location

Chromosome: 8
Locus: NG_012202.1
Locus Location: 5101
Size: 1 bp
Located at: OPG
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Egyptian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Youssry I, Saad N, Madboly M, Samy RM, Hamed ST, Tawfik H, Elbatrawy SR, Kaddah N, Abd Elaziz D, Bone health in pediatric transfusion-dependent beta-thalassemia: Circulating osteoprotegerin and RANKL system., Pediatr Blood Cancer, 69(1), e29377, 2022 PubMed
Created on 2022-02-28 12:29:19, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.