IthaID: 3901



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs77635018 HGVS Name: NC_000006.12:g.43846990C>A | NC_000006.12:g.43846990C>G | NC_000006.12:g.43846990C>T

Context nucleotide sequence:
GAGAGAAATAATCAGAAGTTACTA [ C/G/T/A] GCTGTTTTAACTGAGCATCAGTAAT (Strand: +)

Also known as:

Comments: SNV associated with priapism in a patient sample from the REDS-III Brazil SCD cohort. The minor allele had a protective effect against priapism.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Priapism [HP:0200023] [OMIM:176620]

Location

Chromosome: 6
Locus: NR_149142.1
Locus Location: N/A
Size: 1 bp
Located at: LINC02537
Specific Location: Intron 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Brazilian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Cintho Ozahata M, Page GP, Guo Y, Ferreira JE, Dinardo CL, Carneiro-Proietti ABF, Loureiro P, Mota RA, Rodrigues DOW, Belisario AR, Maximo C, Flor-Park MV, Custer B, Kelly S, Sabino EC, , Clinical and Genetic Predictors of Priapism in Sickle Cell Disease: Results from the Recipient Epidemiology and Donor Evaluation Study III Brazil Cohort Study., J Sex Med, 16(12), 1988-1999, 2019 PubMed
Created on 2022-03-24 16:38:19, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.