IthaID: 4063
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 15 (-G, +CC) | HGVS Name: | HBA2:c.47delinsCC |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
AAGACCAACGTCAAGGCCGCCTGGG [G/CC] TAAGGTCGGCGCGCACGCTGGCGAGTAT (Strand: +)
Protein sequence:
MVLSPADKTNVKAAWKX
Also known as:
Comments: This is an indel mutation that deletes a G nucleotide from codon 15 in exon 1 of the HBA2 gene and inserts two C nucleotides. Frameshift resulting in a shortened α-globin chain with a stop codon at codon 16 [AAG>TAA]. The mutation was found in one Malay individual with the Hb level of 12.2 g/dL, MCV level of 71.1 fl and MCH level of 23.2 pg.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 33822 |
Size: | 1 bp |
Located at: | α2 |
Other details
Type of Mutation: | Insertion & Deletion |
---|---|
Ethnic Origin: | Malay |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Abdul Hamid, Faidatul Syazlin | 2023-07-06 | First report. |
Created on 2023-07-13 10:09:27,
Last reviewed on 2023-07-13 10:13:06 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2023-07-13 10:09:27 | The IthaGenes Curation Team | Created |
2 | 2023-07-13 10:13:06 | The IthaGenes Curation Team | Reviewed. Gene added |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-05-09 11:58:23