IthaID: 4149
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 18 GTG>GTA [Val>Val] | HGVS Name: | HBB:c.57G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCGTTACTGCCCTGTGGGGCAAGGT [G/A] AACGTGGATGAAGTTGGTGGTGAGG (Strand: -)
Comments: Identified in two adult Thai males in compound heterozygosity with Hb E [IthaID:88]. Hematological parameters were as follows; case 1: RBC 5.26×10¹²/L, Hb 12.2 g/dL, Hct 37.1%, MCV 75.0 fL, MCH 23.2 pg, RDW 13.7% and case 2: RBC 6.54×10¹²/L, Hb 14.4 g/dL, Hct 45.0%, MCV 68.0 fL, MCH 22.0 pg, RDW 14.3%. High-performance liquid chromatography revealed an EA pattern in both cases, with Hb E levels of 36.7% and 37.7%, and Hb F levels of 0.9% and 1.1%, respectively.
External Links
No available links
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70650 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Singha, Kritsada | 2025-06-03 | First report. |
| 2 | Fucharoen, Supan | 2025-06-03 | First report. |
| 3 | Pansuwan, Anupong | 2025-06-03 | First report. |