
IthaID: 1195
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 112-116 (+GTGTGCTGGCCC) | HGVS Name: | HBB:c.338_349dupGTGTGCTGGCCC |
| Hb Name: | Hb Antibes-Juan-Les-Pins | Protein Info: | β 116(G18) His->0 AND Arg-Val-Leu-Ala-His- inserted between 115(G17) and 117(G19) of β |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AACGTGCTGGTCTGTGTGCTGGCCC [-/GTGTGCTGGCCC] ATCACTTTGGCAAAGAATTCACCCC (Strand: -)
Comments: Found in a father and his two sons with abnormal haematological parameters. Amino acid residues at positions β115-β119 at the end of helix G in the normal β-globin chain are involved either in α1β1 subunit links or externally on the Hb molecule. The insertion of five amino acid residues leads to the addition of a complete helix turn that has no effect on oxygen binding but decreases molecule stability. Oxygen dissociation curves were normal.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71912 |
| Size: | 12 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | French, Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Lacan P, Becchi M, Zanella-Cleon I, Aubry M, Quinsat D, Couprie N, Francina A, Identification by mass spectrometry of a hemoglobin variant with an elongated beta-globin chain., Clinical chemistry, 51(1), 213-5, 2005
- Theodoridou S, Boutou E, Vyzantiadis TA, Balassopoulou A, Vlachaki E, First Report of a Coincidental Discovery of Hb Antibes-Juan-Les-Pins (: c.349_350insGTGTGCTGGCCC) in a Greek Woman., Hemoglobin, 44(5), 361-363, 2020
Created on 2010-06-16 16:13:17,
Last reviewed on 2021-06-23 12:52:50 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.