IthaID: 1319
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 146/147 (+AC) | HGVS Name: | HBB:c.440_441dupAC |
| Hb Name: | Hb Tak | Protein Info: | β 147(+AC); modified C-terminal sequence: (147)Thr-Lys-Leu- Ala-Phe-Leu-Leu-Ser-Asn-Phe-(157)Tyr-COOH |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TAATGCCCTGGCCCACAAGTATCAC [-/AC] TAAGCTCGCTTTCTTGCTGTCCAAT (Strand: -)
Comments: Insertion of dinucleotide AC between codon 146 and nonsense codon 147 (TAA), causing the elongation of the β-chain by 11 amino acid residues at its C-terminus. The resulting haemoglobin Tak has high oxygen affinity, causing secondary polycythemia.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | Increased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72014 |
| Size: | 2 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Hoyer JD, Wick MJ, Thibodeau SN, Viker KA, Conner R, Fairbanks VF, Hb Tak confirmed by DNA analysis: not expressed as thalassemia in a Hb Tak/Hb E compound heterozygote., Hemoglobin, 22(1), 45-52, 1998
Created on 2010-06-16 16:13:17,
Last reviewed on 2019-11-12 16:35:03 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.