IthaID: 1563
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -109 G>T | HGVS Name: | HBG2:c.-162G>T |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: | Greek non-deletional HPFH |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GTTGGCCAGCCTTGCCTTGACCAATA [G/T] CCTTGACAAGGCAAACTTGACCAATA (Strand: -)
Comments: Identified in a 38-year-old female presenting with elevated Hb F levels (4.1%) and markedly increased Gγ-globin chain production (79.2%). This variant is located at the 3′ end of the HBG2 distal CCAAT box. It abolishes a transcription factor binding site, resulting in enhanced HBG2 transcription and ultimately leading to the HPFH phenotype.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | HPFH |
|---|---|
| Hemoglobinopathy Subgroup: | HPFH |
| Allele Phenotype: | HPFH |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 42726 |
| Size: | 1 bp |
| Located at: | Gγ |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Chassanidis C, Kalamaras A, Phylactides M, Pourfarzad F, Likousi S, Maroulis V, Papadakis MN, Vamvakopoulos NK, Aleporou-Marinou V, Patrinos GP, Kollia P, The Hellenic type of nondeletional hereditary persistence of fetal hemoglobin results from a novel mutation (g.-109G>T) in the HBG2 gene promoter., Annals of hematology, 88(6), 549-55, 2009 PubMed
Created on 2010-06-16 16:13:17,
Last reviewed on 2026-04-17 07:35:21 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.