IthaID: 1573



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -117 G>A HGVS Name: HBG1:c.-170G>A
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCCATGGGTTGGCCAGCCTTGCCTT [A/G] ACCAATAGCCTTGACAAGGCAAACT (Strand: -)

Also known as: Greek/Italian/Black non-deletional HPFH

Comments: HPFH mutation, 7-33% of HbF in individuals carrying beta-thalassaemia mutations. Possibly disrupts binding site (TGACCA) of BCL11A transcriptional repressor.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47642
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Greek, Italian, African
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Collins FS, Metherall JE, Yamakawa M, Pan J, Weissman SM, Forget BG, A point mutation in the A gamma-globin gene promoter in Greek hereditary persistence of fetal haemoglobin., Nature, 313(6000), 325-6, 1985 PubMed
  2. Gelinas R, Endlich B, Pfeiffer C, Yagi M, Stamatoyannopoulos G, G to A substitution in the distal CCAAT box of the A gamma-globin gene in Greek hereditary persistence of fetal haemoglobin., Nature, 313(6000), 323-5, 1985 PubMed
  3. Huang HJ, Stoming TA, Harris HF, Kutlar F, Huisman TH, The Greek A gamma beta+-HPFH observed in a large black family., American journal of hematology, 25(4), 401-8, 1987 PubMed
  4. Ottolenghi S, Camaschella C, Comi P, Giglioni B, Longinotti M, Oggiano L, Dore F, Sciarratta G, Ivaldi G, Saglio G, A frequent A gamma-hereditary persistence of fetal hemoglobin in northern Sardinia: its molecular basis and hematologic phenotype in heterozygotes and compound heterozygotes with beta-thalassemia., Human genetics, 79(1), 13-7, 1988 PubMed
  5. Weber L, Frati G, Felix T, Hardouin G, Casini A, Wollenschlaeger C, Meneghini V, Masson C, De Cian A, Chalumeau A, Mavilio F, Amendola M, Andre-Schmutz I, Cereseto A, El Nemer W, Concordet JP, Giovannangeli C, Cavazzana M, Miccio A, Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype., Sci Adv . , 6(7), 0, 2020 PubMed
Created on 2010-06-16 16:13:17, Last reviewed on 2020-10-08 13:51:56 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.