IthaID: 2081
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A | 
|---|---|---|---|
| Common Name: | CD 328 (CGC>CTC) | HGVS Name: | NG_013087.1:g.7213G>T | 
We follow the 
						 
							HGVS sequence variant nomenclature
						
						and
						 
							 IUPAC standards.
						
					
					
					
Context nucleotide sequence:
TTCGCGCGCTCGGACGAGCTGACCC [G/T] CCACTACCGGAAACACACGGGGCAG  (Strand: -)
Comments: Protein change: R328L, Dominant Lu (a-b-) Phenotype
External Links
No available links
Phenotype
| Allele Phenotype (Cis): | N/A | 
|---|---|
| Allele Phenotype (Trans): | Increased expression for Aγ or Gγ | 
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] | 
Location
| Chromosome: | 19 | 
|---|---|
| Locus: | NG_013087.1 | 
| Locus Location: | 7213 | 
| Size: | 1 bp | 
| Located at: | KLF1 | 
| Specific Location: | Exon 3 | 
Other details
| Type of Mutation: | Point-Mutation(Substitution) | 
|---|---|
| Effect on Gene/Protein Function: | N/A | 
| Ethnic Origin: | Slovakian | 
| Molecular mechanism: | N/A | 
| Inheritance: | Quantitative trait | 
| DNA Sequence Determined: | Yes | 
In silico pathogenicity prediction
Sequence Viewer
								 Note:  The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
								Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
								In such a case, please Refresh the page or retry at a later stage.
								Otherwise, use this external link.
							
							
						Publications / Origin
- Singleton BK, Burton NM, Green C, Brady RL, Anstee DJ, Mutations in EKLF/KLF1 form the molecular basis of the rare blood group In(Lu) phenotype., Blood , 112(5), 2081-8, 2008 PubMed
- Singleton BK, Lau W, Fairweather VS, Burton NM, Wilson MC, Parsons SF, Richardson BM, Trakarnsanga K, Brady RL, Anstee DJ, Frayne J, Mutations in the second zinc finger of human EKLF reduce promoter affinity but give rise to benign and disease phenotypes., Blood , 118(11), 3137-45, 2011 PubMed
- Gallienne AE, Dréau HM, Schuh A, Old JM, Henderson S, Ten novel mutations in the erythroid transcription factor KLF1 gene associated with increased fetal hemoglobin levels in adults., Haematologica , 97(3), 340-3, 2012 PubMed
					Created on 2013-06-28 13:07:50,
					Last reviewed on 2014-03-18 12:01:12					(Show full history)
				
				
			
 Disclaimer: The information on this website is provided as an information resource only
    and must not to be used as a substitute for professional diagnosis and treatment.
    The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
    diagnosis or any other information, services or products that an individual obtains through this website.
