IthaID: 2127



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: -158 C>T HGVS Name: NG_000007.3:g.42677C>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CAACCCATGGGTGGAGTTTAGCCAGG [C/T] ACCGTTTCAGACAGATATTTGCATT (Strand: -)

Comments: Xmn1-Gγ site is common in all population groups and is present at a frequency of 0.32–0.35. Xmn1-Gγ does not always raise the Hb F levels in otherwise normal individuals. Under conditions of haemopoietic stress, for example in homozygous β-thalassaemia and sickle cell disease, presence of the Xmn1-Gγ site favours a higher Hb F response. The presence of the XmnI T/T genotype correlates strongly in response to hydroxyurea treatment in transfusion-dependent β-thal patients. SNP associated with F-cell variation in healthy Northern Europeans (TwinsUK cohort; n=269 and n=775 in two independent studies). It associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1518 and n=1275 in two independent studies) and a Brazilian sickle cell disease (SCD) study sample (n=167). It associated with HbF levels and F-cell numbers in a Hong Kong Chinese sample heterozygous for the β-thalassemia mutation (n=241). It associated with HbF levels and disease severity in a study sample of Thai patients with HbE/β0-thalassemia, who were classified as clinically mild (n=207) or severe (n=305) for the disease. It associated with HbF levels in Portuguese β-thal carriers. It had a modifying effect on HbF and clinical score in Indonesian HbE/β-thal patients. The XmnI T allele associated with elevated HbF in Thai individuals with homozygous HbE (n=115), as well as with high Gγ expression in patients with SCD (Georgia, Turkey, Surinam and Saudi Arabia) and β-thalassemia (Georgia, Algeria and Sicily). The association with HbF was not replicated in SCD patients from Cameroon (n=596) and Tanzania (n=222) [PMID: 33073380]. SNP associated with significantly more pain events in young patients with SCA (BABY HUG cohort) [PMID: 23606168]. SNP associated with good response to HU treatment in terms of Hb levels and blood transfusion dependency both in β-thalassaemia and sickle cell disease cohorts [PMID: 17880608, 14722738, 15477200, 25263325]. Associated with HbF levels and gamma chains ratio (Gγ:Αγ) in an Angolan pediatric population with sickle cell anaemia [PMID: 34069401]. Associated with a robust effect on HbF levels (mean = 16.7±2.1%) in Kuwaiti patients with SCD [PMID: 34204365]. Reported to lead to 2-4% of HbF in heterozygous carriers. Disruption of the -158 binding site via CRISPR-Cas9 induced HbF expression in adult HUDEP-2 erythroid cells [PMID: 32917636]. It identifies the polymorphic site XmnI in the beta-globin gene cluster, which is used in the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian).

External Links

Phenotype

Allele Phenotype (Cis):Increased expression for Gγ
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Pain [HP:0012531]
Hb F response to hydroxyurea
F-cell numbers
Anaemia [HP:0001903]
Severity [HP:0012824]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 42677
Size: 1 bp
Located at: Gγ
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Northern European, African American, Brazilian, Chinese, African, Sicilian, Algerian, Thai, Indonesian, Portuguese, Iranian, Tanzanian, Angolan
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Lanson Y, Reignoux J, Jobard P, Vandooren M, Rouleau P, Soret JY, [Osteogenic sarcoma of the kidney. Apropos of a case. Review of the literature]., J Urol Nephrol (Paris) , 84(10), 827-34, 1978 PubMed
  2. Labie D, Pagnier J, Lapoumeroulie C, Rouabhi F, Dunda-Belkhodja O, Chardin P, Beldjord C, Wajcman H, Fabry ME, Nagel RL, Common haplotype dependency of high G gamma-globin gene expression and high Hb F levels in beta-thalassemia and sickle cell anemia patients., Proc. Natl. Acad. Sci. U.S.A. , 82(7), 2111-4, 1985 PubMed
  3. Gilman JG, Huisman TH, DNA sequence variation associated with elevated fetal G gamma globin production., Blood , 66(4), 783-7, 1985 PubMed
  4. Labie D, Dunda-Belkhodja O, Rouabhi F, Pagnier J, Ragusa A, Nagel RL, The -158 site 5' to the G gamma gene and G gamma expression., Blood , 66(6), 1463-5, 1985 PubMed
  5. Sampietro M, Thein SL, Contreras M, Pazmany L, Variation of HbF and F-cell number with the G-gamma Xmn I (C-T) polymorphism in normal individuals., Blood , 79(3), 832-3, 1992 PubMed
  6. Garner C, Tatu T, Reittie JE, Littlewood T, Darley J, Cervino S, Farrall M, Kelly P, Spector TD, Thein SL, Genetic influences on F cells and other hematologic variables: a twin heritability study., Blood , 95(1), 342-6, 2000 PubMed
  7. Yavarian M, Karimi M, Bakker E, Harteveld CL, Giordano PC, Response to hydroxyurea treatment in Iranian transfusion-dependent beta-thalassemia patients., Haematologica, 89(10), 1172-8, 2004 PubMed
  8. Thein SL, Genetic insights into the clinical diversity of beta thalassaemia., Br. J. Haematol. , 124(3), 264-74, 2004 PubMed
  9. Alebouyeh M, Moussavi F, Haddad-Deylami H, Vossough P, Hydroxyurea in the treatment of major beta-thalassemia and importance of genetic screening., Ann. Hematol. , 83(7), 430-3, 2004 PubMed
  10. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007 PubMed
  11. Bradai M, Pissard S, Abad MT, Dechartres A, Ribeil JA, Landais P, de Montalembert M, Decreased transfusion needs associated with hydroxyurea therapy in Algerian patients with thalassemia major or intermedia., Transfusion , 47(10), 1830-6, 2007 PubMed
  12. Ma Q, Abel K, Sripichai O, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Fucharoen S, Braun A, Farrer LA, Beta-globin gene cluster polymorphisms are strongly associated with severity of HbE/beta(0)-thalassemia., Clin. Genet. , 72(6), 497-505, 2007 PubMed
  13. Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008 PubMed
  14. Koren A, Levin C, Dgany O, Kransnov T, Elhasid R, Zalman L, Palmor H, Tamary H, Response to hydroxyurea therapy in beta-thalassemia., Am. J. Hematol. , 83(5), 366-70, 2008 PubMed
  15. Gibney GT, Panhuysen CI, So JC, Ma ES, Ha SY, Li CK, Lee AC, Li CK, Yuen HL, Lau YL, Johnson DM, Farrell JJ, Bisbee AB, Farrer LA, Steinberg MH, Chan LC, Chui DH, Variation and heritability of Hb F and F-cells among beta-thalassemia heterozygotes in Hong Kong., Am. J. Hematol. , 83(6), 458-64, 2008 PubMed
  16. Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008 PubMed
  17. Italia KY, Jijina FJ, Merchant R, Panjwani S, Nadkarni AH, Sawant PM, Nair SB, Ghosh K, Colah RB, Response to hydroxyurea in beta thalassemia major and intermedia: experience in western India., Clin. Chim. Acta , 407(1), 10-5, 2009 PubMed
  18. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010 PubMed
  19. Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010 PubMed
  20. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011 PubMed
  21. Banan M, Bayat H, Azarkeivan A, Mohammadparast S, Kamali K, Farashi S, Bayat N, Khani MH, Neishabury M, Najmabadi H, The XmnI and BCL11A single nucleotide polymorphisms may help predict hydroxyurea response in Iranian β-thalassemia patients., Hemoglobin , 36(4), 371-80, 2012 PubMed
  22. Akinsheye I, Solovieff N, Ngo D, Malek A, Sebastiani P, Steinberg MH, Chui DH, Fetal hemoglobin in sickle cell anemia: molecular characterization of the unusually high fetal hemoglobin phenotype in African Americans., Am J Hematol, 87(2), 217-9, 2012 PubMed
  23. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
  24. Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013 PubMed
  25. Pakdee N, Yamsri S, Fucharoen G, Sanchaisuriya K, Pissard S, Fucharoen S, Variability of hemoglobin F expression in hemoglobin EE disease: hematological and molecular analysis., Blood Cells Mol. Dis. , 53(1), 11-5, 2014 PubMed
  26. Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014 PubMed
  27. Cardoso GL, Diniz IG, Silva AN, Cunha DA, Silva Junior JS, Uchôa CT, Santos SE, Trindade SM, Cardoso Mdo S, Guerreiro JF, DNA polymorphisms at BCL11A, HBS1L-MYB and Xmn1-HBG2 site loci associated with fetal hemoglobin levels in sickle cell anemia patients from Northern Brazil., Blood Cells Mol. Dis. , 53(4), 176-9, 2014 PubMed
  28. Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015 PubMed
  29. Mtatiro SN, Makani J, Mmbando B, Thein SL, Menzel S, Cox SE, Genetic variants at HbF-modifier loci moderate anemia and leukocytosis in sickle cell disease in Tanzania., Am. J. Hematol., 90(1), E1-4, 2015 PubMed
  30. Vathipadiekal V, Alsultan A, Baltrusaitis K, Farrell JJ, Al-Rubaish AM, Al-Muhanna F, Naserullah Z, Suliman A, Patra PK, Milton JN, Farrer LA, Chui DH, Al-Ali AK, Sebastiani P, Steinberg MH, Homozygosity for a haplotype in the HBG2-OR51B4 region is exclusive to Arab-Indian haplotype sickle cell anemia., Am. J. Hematol. , 91(6), E308-11, 2016 PubMed
  31. Rujito L, Basalamah M, Siswandari W, Setyono J, Wulandari G, Mulatsih S, Sofro AS, Sadewa AH, Sutaryo S, Modifying effect of XmnI, BCL11A, and HBS1L-MYB on clinical appearances: A study on β-thalassemia and hemoglobin E/β-thalassemia patients in Indonesia., Hematol Oncol Stem Cell Ther , 9(2), 55-63, 2016 PubMed
  32. Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017 PubMed
  33. Weber L, Frati G, Felix T, Hardouin G, Casini A, Wollenschlaeger C, Meneghini V, Masson C, De Cian A, Chalumeau A, Mavilio F, Amendola M, Andre-Schmutz I, Cereseto A, El Nemer W, Concordet JP, Giovannangeli C, Cavazzana M, Miccio A, Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype., Sci Adv . , 6(7), 0, 2020 PubMed
  34. Delgadinho M, Ginete C, Santos B, Miranda A, Brito M, Genotypic Diversity among Angolan Children with Sickle Cell Anemia., Int J Environ Res Public Health, 18(10), 0, 2021 PubMed
  35. Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021 PubMed
Created on 2013-09-24 12:25:07, Last reviewed on 2022-09-13 15:06:00 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.