IthaID: 2208


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 24 TAT>TAG HGVS Name: HBA2:c.75T>G
Hb Name: N/A Protein Info: α2 24(B5) Tyr>Stop

Context nucleotide sequence:
AGGTCGGCGCGCACGCTGGCGAGTA [G/T] GGTGCGGAGGCCCTGGAGAGGTGAG (Strand: +)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33850
Size: 1 bp
Located at: α2
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation)
Ethnic Origin: Dutch
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Giordano PC, Cnossen MH, Joosten AM, Jansen CA, Hakvoort TE, Bakker-Verweij M, Arkesteijn SG, van Delft P, Waye JS, Bouva MJ, Harteveld CL, Codon 24 (TAT>TAG) and codon 32 (ATG>AGG) (Hb Rotterdam): two novel alpha2 gene mutations associated with mild alpha-thalassemia found in the same family after newborn screening., Hemoglobin , 34(4), 354-65, 2010
Created on 2013-10-02 10:37:38, Last reviewed on 2014-04-09 10:22:53 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.