
IthaID: 2381
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | CD 32 ATG>AAG [Met>Lys] | HGVS Name: | HBA1:c.98T>A |
| Hb Name: | Hb Queens Park | Protein Info: | α1 32(B13) Met>Lys |
| Also known as: | Hb Chao Pra Ya |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCTCACTCTGCTTCTCCCCGCAGGA [A/T] GTTCCTGTCCTTCCCCACCACCAAG (Strand: +)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
| Allele Phenotype: | α⁺ |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37794 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Burmese, Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Phylipsen M, Prior JF, Lim E, Lingam N, Finlayson J, Arkesteijn SG, Harteveld CL, Giordano PC, Two new alpha1-globin gene point mutations: Hb Nedlands (HBA1:c.86C>T) [alpha28(B9)Ala-->Val] and Hb Queens Park (HBA1:c.98T>A) [alpha32(B13)Met-->Lys]., Hemoglobin , 34(2), 123-6, 2010
- Viprakasit V, Ekwattanakit S, Chalaow N, Riolueang S, Wijit S, Tanyut P, Chat-Uthai N, Tachavanich K, Clinical presentation and molecular identification of four uncommon alpha globin variants in Thailand. Initiation codon mutation of α2-globin Gene (HBA2:c.1delA), donor splice site mutation of α1-globin gene (IVSI-1, HBA1:c.95 + 1G>A), hemoglobin Queens Park/Chao Pra Ya (HBA1:c.98T>A) and hemoglobin Westmead (HBA2:c.369C>G)., Acta Haematol. , 131(2), 88-94, 2014
Created on 2014-05-26 10:39:21,
Last reviewed on 2022-07-12 13:27:48 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.