Loading... Please wait!
Quick filtering
Showing all entries involving gene α1 (Show All):
IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
---|---|---|---|---|---|---|---|---|
2252 | --BR | N/A | NC_000016.10:g.11555_229482del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
2268 | --BA | N/A | NC_000016.10:g.0_772369del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
2555 | α12 (HBA2 gene conversion) | N/A | N/A | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
2561 | ααα(anti-3.7) (Triplicated α (anti-3.7)) | N/A | NG_000006.1:g.34247_38050dup | α2, α1 | Modifier | α-thalassaemia, Anaemia | NG_000006.1 | |
2567 | BS duplication | N/A | NC_000016.10:g.(85585_100579)_ (360915_410354)dup | HS40, ζ, α2, α1 | Modifier | α-thalassaemia | NG_000006.1 | |
2568 | FD duplication | N/A | NC_000016.10:g.55826_(185840_187594)dup | HS40, ζ, α2, α1 | Modifier | α-thalassaemia | NG_000006.1 | |
2570 | Sardinian duplication | N/A | N/A | HS40, ζ, α2, α1 | Modifier | α-thalassaemia | NG_000006.1 | |
3070 | αααα282 (αααα222) | N/A | NC_000016.10:g.44054_44055ins[NC_000016.10:g.10001_232200] | HS40, ζ, α2, α1, NPRL3 | Modifier | α-chain variant | NG_000006.1 | |
3071 | --235 (--175) | N/A | NC_000016.10:g.10001_185264del | HS40, ζ, α2, α1, NPRL3 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
3076 | αααα391 | N/A | NC_000016.10:g.101440_492029dup | HS40, ζ, α2, α1, NPRL3 | Modifier | α-chain variant | NG_000006.1 | |
3265 | α-globin cluster triplication | N/A | NC_000016.10:g.(53322_113530)_(181203_206337)dup | HS40, ζ, α2, α1, HBM | Modifier | α-thalassaemia | NG_000006.1 | |
3292 | 15 kb deletion | N/A | NC_000016.10:g.172736_187935del | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
3296 | --GB | N/A | NC_000016.9:g.(161901_161910)_(178672_178681)del | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
3432 | Hkαα | N/A | N/A | α2, α1, α3.7 hybrid | Neutral | N/A | NG_000006.1 | |
3588 | --OY | N/A | NC_000016.10:g.0_318541del | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
3622 | --71.8 (71.8 Kb deletion) | N/A | NC_000016.10:g.138971_210817del | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
3821 | --196 | N/A | NC_000016.10:g.35880_(232158_243266)del | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | |
3822 | --227 | N/A | NC_000016.10:g.35880_(262740_268502)del | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | |
3937 | 188.7 kb dup | N/A | NC_000016.10:g.62166_250991del | HS40, ζ, α2, α1, NPRL3, HBM | Modifier | N/A | NG_000006.1 | |
3938 | 120.5 kb dup | N/A | NC_000016.10:g.98546_219042del | HS40, ζ, α2, α1, NPRL3, HBM | Modifier | N/A | NG_000006.1 | |
3939 | ~274 kb dup | N/A | N/A | HS40, ζ, α2, α1, NPRL3, HBM, AXIN1 | Modifier | N/A | NG_000006.1 | |
3948 | -α3.7αα (α triplication) | N/A | N/A | α2, α1, α3.7 hybrid | Modifier | α-thalassaemia | NG_000006.1 | |
4010 | αααα(anti-3.7) | N/A | N/A | α2, α1 | Modifier | α-thalassaemia | NG_000006.1 | |
4014 | αααα(159) | N/A | NC_000016.10:g.(63142_63147)_(222524_222529)dup | ζ, α2, α1, NPRL3, HBM | Modifier | α-thalassaemia | NG_000006.1 | |
4015 | --259 | N/A | NC_000016.10:g.27301_286500del | HS40, ζ, α2, α1, NPRL3 | Causative | α-thalassaemia | NG_000006.1 | |
4058 | --FG | N/A | N/A | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
4059 | --Sciacca | N/A | N/A | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
4060 | --AG | N/A | NC_000016.10:g.10001_(284537_284542)del | HS40, ζ, α2, α1, NPRL3, HBM | Causative | α-thalassaemia | NG_000006.1 | |
4061 | --Puglia | N/A | NC_000016.10:g.(54016_55432)_(220780_223388)del | HS40, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | |
4062 | 285 kb deletion | N/A | N/A | HS40, ζ, α2, α1, HBM, AXIN1 | Causative | α-thalassaemia | NG_000006.1 | |
4082 | --LAMPHUN (27 kb deletion with 9 bp insertion (Lamphun deletion)) | N/A | N/A | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | |
4090 | --Mococa (17 kb deletion) | N/A | NC_000016.10:g.(162059_162078)_(179126_179145)del | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
4095 | --Guigang (145 kb deletion) | N/A | NC_000016.10:g.127815_273190del | HS40, ζ, α2, α1, NPRL3, HBM | Causative | α-thalassaemia | NG_000006.1 | |
4101 | αααα(165) | N/A | NC_000016.10:g.59867_224557dup | HS40, ζ, α2, α1, NPRL3, HBM | Modifier | N/A | NG_000006.1 | |
307 | -α18 (18 kb deletion) | N/A | N/A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
316 | -(α)5.2 | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
322 | --CI (28+ kb deletion.) | N/A | NC_000016.10:g.(158380_161516)_ (186053_?) | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
324 | --115 | N/A | NC_000016.10:g.(13158_13584)_(39907_41256)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
326 | --YEM | N/A | NG_000006.1:g.(16201_17547)_(41420_42633)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
329 | --KOL | N/A | NC_000016.10:g.(151719_151746)_(185067_185093)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
330 | --11.1 (11.1 kb deletion) | N/A | NG_000006.1:g.(31695_31724)_(42846_42867)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
331 | --OH | N/A | NC_000016.10:g.(149158_152418)_(249560_284571)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2235 | α-αΔ970 (970 bp deletion) | N/A | NG_000006.1:g.36599_37568delinsTAG | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2236 | --DUTCH I | N/A | NG_000006.1:g.7622_41156del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2237 | --AW | N/A | NG_000006.1:g.32143_40317delinsCTCCCTGGACAAGT | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2238 | --BGS | N/A | NC_000016.10:g.47749_179374del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2239 | --CAMPANIA | N/A | NC_000016.10:g.(8635_8924)_(39835_40133)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2240 | --FIL-2 (27.9 deletion) | N/A | NC_000016.10:g.156188_184103del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2241 | --ED | N/A | NC_000016.10:g.(110582_113386)_(187266_188773)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2242 | --GP | N/A | NC_000016.10:g.(43803_47123)_(187266_188649)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2253 | --ZW | N/A | NC_000016.10:g.11555_229482del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2254 | --JY | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2255 | --LC | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2256 | --VR | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2257 | --JT | N/A | NC_000016.10:g.(44035_44092)_(312033_312090)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2258 | --AB | N/A | NC_000016.10:g.(?_55799)_(360870_410354)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2259 | --GZ | N/A | NC_000016.10:g.(?_53322)_(879639_910965)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2260 | Dutch II | N/A | NC_000016.10:g.(?_55799)_(284538_298092)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2261 | --MK | N/A | NC_000016.10:g.(113696_130566)_(298093_ 331093)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2262 | --80 | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2264 | --Brazil | N/A | NC_000016.10:g.(?_55799)_(986613_1063737)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2265 | --PV | N/A | NC_000016.10:g.(?_55799)_(1625950_1740473)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2266 | --HN | N/A | NC_000016.10:g.(?_55799)_(1923864_ 1939057)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2267 | --FT | N/A | NC_000016.10:g.(?_55799)_(1857769_1890275)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2269 | --TN | N/A | NC_000016.10:g.0_976709del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2270 | --BO | N/A | NC_000016.10:g.0_1896761del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2271 | --IM | N/A | NC_000016.10:g.0_2021644del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2272 | --LIN | N/A | NC_000016.10:g.0_2023655del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2273 | --GS | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3021 | --JAL | N/A | NC_000016.10:g.(149437_149482)_(179595_179654)del | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3022 | --LOD | N/A | NC_000016.10:g.(45349_45393)_(262286_262330)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3067 | --MEX1 | N/A | NG_000006.1:g.3(33114_33812)_(40649_42021)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3068 | --MEX2 | N/A | NC_000016.10:g.(113775_130542)_(208161_249560)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3215 | --Braz | N/A | NC_000016.10:g.(167305_169853)_(239884_271794)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3244 | −KOZANI | N/A | NC_000016.10:g.(113686_143638)_(407521_?)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3255 | --MEX3 | N/A | NC_000016.10:g.151479_182582del | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 0 |
3258 | --NFLD | N/A | NC_000016.10:g.169197_259919delinsCACCCAGCACCCAGTACCA | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3273 | --VS | N/A | NC_000016.10:g.(100364_105222)_(376261_986851)del | HS40, ζ, α2, α1, HBM, AXIN1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3274 | --CBR | N/A | NC_000016.10:g.(?_53322)_(177893_179815)del | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 0 |
3283 | --JS | N/A | NG_000006.1:g.35801_38338delinsGGCCTCCCAACGGGCCCTCCTCCCCTCCT | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3284 | --PG | N/A | NC_000016.10:g.93628_542759del450131 | HS40, ζ, α2, α1, NPRL3, HBM, AXIN1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3295 | 225 kb deletion | N/A | NC_000016.10:g.56407_281805del | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3327 | --GX | N/A | NC_000016.10:g.(41492_43628)_(247888_254167)del | HS40, ζ, α2, α1, NPRL3, HBM | Causative | α-thalassaemia | NG_000006.1 | 0 |
3433 | anti-Hkαα | N/A | N/A | α2, α1 | Neutral | N/A | NG_000006.1 | 0 |
3514 | 170 kb deletion | N/A | N/A | α2, α1, AXIN1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
327 | --MC | N/A | NC_000016.10:g.139301_182501del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 164 |
3607 | 63 Kb deletion | N/A | NC_000016.10:g.(143655_149367)_(181204_206338)del | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 4518 |
3214 | 44.6 kb deletion | N/A | NC_000016.10:g.144215_188841del | ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 5078 |
3595 | --CR | Hb Chiang Rai | NC_000016.10:g.144215_188843del | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 5078 |
4057 | --PA | N/A | NC_000016.10:g.(146281_146304)_(180074_180097)del | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 7144 |
3408 | --60.2 | N/A | NC_000016.10:g.147589_207883del | ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8452 |
323 | --CAL | N/A | NG_000006.1:g.8464_40664del32201 | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8464 |
313 | --MED II | N/A | NG_000006.1:g.(7740_9712)_(39907_41156)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8726 |
3020 | --DANE | N/A | NG_000006.1: g.8800_40007del31208 | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 8800 |
4110 | 146 kb deletion | N/A | NC_000016.10:g.148636_295089del | ζ, α2, α1, HBM, AXIN1 | Causative | α-thalassaemia | NG_000006.1 | 9499 |
3963 | 32.8 kb deletion | N/A | NC_000016.10:g.149860_182697del | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 10723 |
310 | --THAI | N/A | NC_000016.10:g.149863_183312del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 10726 |
325 | --RT | N/A | NC_000016.10:g.151401_188301del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 12264 |
311 | --FIL | N/A | NC_000016.10:g.151641_182316del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 12504 |
321 | --CL | N/A | NC_000016.10:g.152451_263801del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 13314 |
4019 | 27.2 kb deletion (--27.2) | N/A | NC_00016.10:g.154539_181778delinsTAACA | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 15402 |
320 | --BRIT | N/A | NC_000016.10:g.155501_184801del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 16364 |
314 | -(α)20.5 | N/A | NG_000006.1:g.(18148_18200)_(37868_37901)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 18200 |
319 | --MA | N/A | NG_000006.1:g.18964_39864del20901 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 18964 |
315 | --SA | N/A | NC_000016.10:g.159052_182788delins139752_139596 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 19464 |
3947 | 27.3 kb deletion | N/A | NC_000016.10:g.158664_185974del | α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 19527 |
3294 | 22 kb deletion | N/A | NG_000006.1:g.20350_42078del | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 20350 |
312 | --MED I | N/A | NG_000006.1:g.(23641_23662)_(41183_41203)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 23662 |
3945 | 15.8 kb deletion (NG_000006.1:g.24749_40631del) | N/A | NC_000016.10:g.163886_179768del | α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 24749 |
309 | --SEA | N/A | NC_000016.10:g.165401_184701del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 26264 |
328 | --CANT | N/A | NC_000016.10:g.(168531_169756)_(182770_183028)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 29394 |
4020 | 14.9 kb deletion | N/A | NC_00016.10:g.168803_183737del | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 29666 |
318 | --SPAN | N/A | NC_000016.10:g.(169756_170100)_(179044_181595)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 30619 |
3018 | --NOR | N/A | NC_000016.10:g.170694_184101del | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 31577 |
3360 | 9.7 kb deletion | N/A | NG_000006.1:g.32709_42418del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 32709 |
317 | --GEO | N/A | NG_000006.1:g.32864_42264del9401 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 32864 |
3994 | 10.3 kb deletion | N/A | NC_000016.10:g.172342_182690del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33205 |
4083 | -(α)4.9 (4.9 Kb deletion) | N/A | NC_000016.10:g.172367_177259delinsG | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 33230 |
432 | CD 1 GTG>GGG [Val>Gly] | Hb Antananarivo | HBA1:c.5T>G | HBA2:c.5T>G | α1, α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33780, 37584 |
2499 | CD 12 GCC>GAC [Ala>Asp] (Hb J-Aljezur) | Hb J-Paris-I | HBA1:c.38C>A | α1 | Causative | α-chain variant | NG_000006.1 | 33813 |
2416 | CD 99 AAG>ATG [Lys>Met] | N/A | HBA1:c.299A>T | α1 | Causative | α-chain variant | NG_000006.1 | 34191 |
300 | -α3.7 (type I) (-α3.7) | N/A | NG_000006.1:g.34247_38050del | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34247 |
4078 | CD 108 ACC>CCC [Thr>Pro] | N/A | HBA1:c.325A>C | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34359 |
2991 | CD 108 ACC>AAC [Thr>Asn] | Hb Rogliano | HBA1:c.326C>A | α1 | Causative | α-chain variant | NG_000006.1 | 34360 |
398 | CD 109 (-C) | Hb Sciacca | HBA1:c.328delC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34362 |
2571 | CD 109 CTG>CCG [Leu>Pro] | Hb Milano | HBA1:c.329T>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34363 |
3982 | CD 111 GCC>TCC [Ala>Ser] | Hb Liuzhou-Yufeng | HBA1:c.334G>T | α1 | Causative | α-chain variant | NG_000006.1 | 34368 |
2230 | -α3.7 (type II) | N/A | NG_000006.1:g.34478_38288del | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34478 |
4041 | 3.8 kb deletion | N/A | NC_000016.10:g.173682_177493del | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 34545 |
2231 | -α3.7 (type III) | N/A | NG_000006.1:g.34570_38381del | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34570 |
2263 | α-ZF | N/A | NC_000016.10:g.174046_192396del | α1 | Causative | α-thalassaemia | NG_000006.1 | 34909 |
303 | -α2.7 | N/A | NG_000006.1:g.36664_39364del2701 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 36664 |
302 | -α2.4 | N/A | NG_000006.1:g.36859_39252del | α1 | Causative | α-thalassaemia | NG_000006.1 | 36859 |
3072 | 125 bp deletion | N/A | NG_000006.1: g.37040_37164del | α1 | Neutral | N/A | NG_000006.1 | 37040 |
304 | -α3.5 | N/A | NG_000006.1:g.37464_40964del3501 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37464 |
3740 | -5 C>T | N/A | HBA1:c.-42C>T | α1 | Neutral | α-thalassaemia | NG_000006.1 | 37538 |
3764 | -4 G>C | N/A | HBA1:c.-41C>G | α1 | Causative | α-thalassaemia | NG_000006.1 | 37539 |
3614 | CAP +14 C>G | N/A | HBA1:c.-24C>G | α1 | Neutral | α-thalassaemia | NG_000006.1 | 37556 |
340 | CAP +22 T>C | N/A | HBA1:c.-16T>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37564 |
3735 | Cap +23 C>G | N/A | HBA1:c.-15C>G | α1 | Causative | α-thalassaemia | NG_000006.1 | 37565 |
2203 | CAP +29 (G>C) | N/A | HBA1:c.-9G>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37571 |
341 | Init CD ATG>GTG | N/A | HBA1:c.1A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37580 |
3147 | Init CD ATG>AAG [Met>Lys] | N/A | HBA1:c.2T>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37581 |
3250 | Init CD ATG>A-G | N/A | HBA1:c.2delT | α1 | Causative | α-thalassaemia | NG_000006.1 | 37581 |
3719 | Init CD ATG>ACG [Met>Thr] | N/A | HBA1:c.2T>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37581 |
429 | CD 1 GTG>TTG [Val>Leu] | Hb Baldock | HBA1:c.4G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37583 |
435 | CD 2 CTG>CGG [Leu>Arg] | Hb Chongqing | HBA1:c.8T>G | α1 | Causative | α-chain variant | NG_000006.1 | 37587 |
3699 | CD 2 CTG>CCG [Leu>Pro] | Hb Kaiser West End | HBA1:c.8T>C | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37587 |
2352 | CD 2/3 +CTG [+Leu] | Hb Pittsburgh | HBA1:c.9_10insCTG | α1 | Causative | α-chain variant | NG_000006.1 | 37588 |
437 | CD 3 TCT>TTT [Ser>Phe] | Hb Douala | HBA1:c.11C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37590 |
3981 | CD 5 GCC>ACC [Ala>Thr] | Hb Hengqin I | HBA1:c.16G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37595 |
441 | CD 5 GCC>GAC [Ala>Asp] | Hb J-Toronto | HBA1:c.17C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37596 |
442 | CD 6 GAC>TAC [Asp>Tyr] | Hb Woodville | HBA1:c.19G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37598 |
444 | CD 6 GAC>CAC [Asp>His] | Hb Galliera I | HBA1:c.19G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37598 |
3922 | CD 6 GAC>GAG [Asp>Glu] | Hb Brammer | HBA1:c.21C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37600 |
450 | CD 7 AAG>GAG [Lys>Glu] | Hb Kurosaki | HBA1:c.22A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37601 |
4006 | CD 7 AAG>A-G (g.188 (GenBank MK600512.1)) | N/A | HBA1:c.23delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37602 |
2987 | CD 9 AAC>GAC [Asn>Asp] | Hb Farnborough | HBA1:c.28A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37607 |
453 | CD 9 AAC>AGC [Asn>Ser] | Hb Anadour | HBA1:c.29A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37608 |
456 | CD 9 AAC>AAG or AAA [Asn>Lys] | Hb Delfzicht | HBA1:c.30C>G | HBA1:c.30C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37609 |
3953 | CD 11 AAG>CAG [Lys>Gln] | Hb J-Wenchang-Wuming | HBA1:c.34A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37613 |
2386 | CD 13 GCC>ACC [Ala>Thr] | Hb Olivet | HBA1:c.40G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37619 |
347 | CD 14 TGG>CGG [Trp>Arg] | Hb Evanston | HBA1:c.43T>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37622 |
349 | CD 14 TGG>TAG [Trp>STOP] | N/A | HBA1:c.44G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37623 |
2380 | CD 14 TGG>TTG [Trp>Leu] | Hb Basel | HBA1:c.44G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37623 |
465 | CD 15 GGT>CGT [Gly>Arg] (Hb Siam) | Hb Ottawa | HBA1:c.46G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37625 |
2365 | CD 15 GGT>TGT [Gly>Cys] | Hb St. Rose | HBA1:c.46G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37625 |
466 | cd 15 GGT>GAT [Gly>Asp] (Hb J-Oxford , Hb N-Cosenza) | Hb I-Interlaken | HBA1:c.47G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37626 |
2509 | CD 16 AAG>GAG [Lys>Glu] (Hb I-Burlington, Hb I-Philadelphia, Hb I-Skamania, Hb I-Texas) | HbI | HBA1:c.49A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37628 |
3395 | CD 16 AAG>TAG [Lys>STOP] | N/A | HBA1:c.49A>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37628 |
468 | CD 16 AAG>ATG [Lys>Met] | Hb Harbin | HBA1:c.50A>T | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37629 |
471 | CD 18 GGC>CGC [Gly>Arg] | Hb Handsworth | HBA1:c.55G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37634 |
2353 | CD 18 GGC>TGC [Gly>Cys] | Hb Lima | HBA1:c.55G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37634 |
3000 | CD 18 GGC>AGC [ Gly>Ser] | Hb King Ecgbert | HBA1:c.55G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37634 |
2205 | CD 20 +T | N/A | HBA1:c.62_63insT | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37641 |
2285 | CD 20 CAC>CCC [His>Pro] (Hb Anderlecht) | Hb Fulton-Georgia | HBA1:c.62A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37641 |
2317 | CD 20 CAC>CAA [His>Gln] (Hb Le Lamentin) | Hb Brugg | HBA1:c.63C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37642 |
4102 | CD 20 CAC>CAG [His>Gln] | Hb Ormylia | HBA1:c.63C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37642 |
482 | CD 21 GCT>GAT [Ala>Asp] | Hb J-Nyanza | HBA1:c.65C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37644 |
3266 | CD 22 GGC>GGT [Gly>Gly] | N/A | HBA1:c.69C>T | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37648 |
3267 | CD 23 GAG>TAG | N/A | HBA1:c.70G>T | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37649 |
3757 | CD 23 GAG>CAG [Glu>Gln] | Hb Memphis | HBA1:c.70G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37649 |
491 | CD 24 TAT>TGT [Tyr>Cys] | Hb Ramona | HBA1:c.74A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37653 |
3954 | CD 16 AAG>AAC [Lys>Asn] | Hb Beijing | HBA1:c.51G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37656 |
3942 | CD 26 GCG>GGG [Ala>Gly] | N/A | HBA1:c.80C>G | α1 | Causative | α-thalassaemia | NG_000006.1 | 37659 |
2510 | CD 27 GAG>GAC [Glu>Asp] | Hb Hekinan | HBA1:c.84G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37663 |
2983 | CD 27 GAG>GAT [Glu>Asp] | Hb Hekinan II | HBA1:c.84G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37663 |
2995 | CD 28 GCC>ACC [Ala>Thr] | Hb Bramall Lane | HBA1:c.85G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37664 |
3032 | CD 28 GCC>TCC [Ala>Ser] | N/A | HBA1:c.85G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37664 |
2313 | CD 28 GCC>GTC [Ala>Val] | Hb Nedlands | HBA1:c.86C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37665 |
2310 | CD 29 CTG>GTG [Leu>Val] | Hb Kosovo | HBA1:c.88C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37667 |
502 | CD 30 GAG>CAG [Glu>Gln] (Hb G-Chinese, Hb G-Hong Kong, Hb G-Singapore) | Hb G-Honolulu | NM_000558.5(HBA1):c.91G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37670 |
3030 | CD 30 GAG>TAG | N/A | HBA1:c.91G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37670 |
3767 | CD 30 GAG>AAG [Glu>Lys] | Hb O-Padova | HBA1:c.91G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37670 |
504 | CD 30 GAG>GCG [Glu>Ala] | Hb Bom Jesus da Lapa | HBA1:c.92A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37671 |
505 | CD 30 GAG>GTG [Glu>Val] | Hb Itapira | HBA1:c.92A>T | α1 | Causative | α-chain variant | NG_000006.1 | 37671 |
2402 | CD 31 AGG>ACG [Arg>Thr] | Hb Mao | HBA1:c.95G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37674 |
358 | IVS I-1 AGGT>AGAT donor | N/A | HBA1:c.95+1G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37675 |
3049 | IVS I-1 AGGT>AGCT donor | N/A | HBA1:c.95+1G>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37675 |
2204 | IVS I-4 A>G | N/A | HBA1:c.95+4A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37678 |
361 | IVS I-5 G>A | N/A | HBA1:c.95+5 G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37679 |
3431 | IVS I-38 C>T | N/A | HBA1:c.95+38C>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37712 |
3768 | IVS I-39 C>T | N/A | HBA1:c.95+39C>T | α1 | Neutral | N/A | NG_000006.1 | 37713 |
3782 | IVS I-41 G>T | N/A | NM_000558.5(HBA1):c.95+41G>T | α1 | Neutral | N/A | NG_000006.1 | 37715 |
2212 | IVS I-45 G>C | N/A | HBA1:c.95+45G>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37719 |
2451 | IVS I-116 A>G | N/A | HBA1:c.96-2A>G | α1 | Causative | α-thalassaemia | NG_000006.1 | 37790 |
364 | IVS I-117 GCAGGA>GCAAGA acceptor | N/A | HBA1:c.96-1G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37791 |
3251 | IVS I-117 GCAGGA>GCACGA acceptor | N/A | HBA1:c.96-1G>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37791 |
2381 | CD 32 ATG>AAG [Met>Lys] (Hb Chao Pra Ya) | Hb Queens Park | HBA1:c.98T>A | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37794 |
2986 | CD 32 ATG>ACG [Met>Thr] | Hb Bridlington | HBA1:c.98T>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37794 |
3252 | CD 32 ATG>ATA [Met>Ile] | Hb Amsterdam-A1 | HBA1:c.99G>A | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37795 |
509 | CD 34 CTG>CGG [Leu>Arg] (Hb Ogi) | Hb Queens | HBA1:c.104T>G | α1 | Causative | α-chain variant | NG_000006.1 | 37800 |
2968 | CD 36 TTC>TAC [ Phe>Tyr] | Hb Kempten | HBA1:c.110T>A | α1 | Causative | α-chain variant | NG_000006.1 | 37806 |
370 | CD 37 -CCC [-Pro) | Hb Heraklion | HBA1:c.112_114delCCC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37808 |
4077 | CD 37 CCC>CC- | N/A | HBA1:c.114del | α1 | Causative | α-thalassaemia | NG_000006.1 | 37810 |
517 | CD 38 ACC>ATC [Thr>Ile] | Hb Chelsea | HBA1:c.116C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37812 |
371 | CD 39 (-ACC) [-Thr] | Hb Taybe | HBA1:c.118_120del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37814 |
3856 | CD 40-41 (-AAGACC) | N/A | HBA1:c.121_126delAAGACC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37817 |
522 | CD 40 AAG>ACG [Lys>Thr] | Hb Pisa | HBA1:c.122A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37818 |
523 | CD 40 AAG>AAC [Lys>Asn] | Hb Saratoga Springs | HBA1:c.123G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37819 |
2385 | CD 42 TAC>TCC [Tyr>Ser] | Hb Erzeroum | HBA1:c.128A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37824 |
3557 | CD 43 TTC>CTC [Phe>Leu] | Hb Vanvitelli | HBA1:c.130T>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37826 |
530 | CD 44 CCG>GCG [Pro>Ala] (Hb Milne) | Hb Hagerstown | HBA1:c.133C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37829 |
3264 | CD 44 CCG>TCG [Pro>Ser] | Hb Wiangpapao | HBA1:c.133C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37829 |
2468 | CD 44 +C | N/A | HBA1:c.134_135insC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37830 |
536 | CD 45 CAC>CGC [His>Arg] | Hb Fort de France | HBA1:c.137A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37833 |
542 | CD 47 GAC>AAC [Asp>Asn] | Hb Arya | HBA1:c.142G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37838 |
2500 | CD 47 GAC>CAC [Asp>His] (Hb L-Ferrara, Hb Michigan-I, Hb Michigan-II, Hb Sealy, Hb Sinai) | Hb Hasharon | HBA1:c.142G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37838 |
547 | CD 48 CTG>CCG [Leu>Pro] | Hb Reading | HBA1:c.146T>C | α1 | Causative | α-chain variant | NG_000006.1 | 37842 |
3040 | CD 48 CTG>CGG [Leu>Arg] | Hb Montgomery | HBA1:c.146T>G | α1 | Causative | α-chain variant | NG_000006.1 | 37842 |
3026 | CD 49 AGC>CGC [Ser>Arg] | Hb Puerta del Sol | HBA1:c.148A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37844 |
2993 | CD 49 AGC>AAC [Ser>Asn] | Hb Furuset | HBA1:c.149G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37845 |
2529 | CD 50 +GGAGCC | Hb Bakersfield | HBA1:c.151_152insGGAGCC | α1 | Causative | α-chain variant | NG_000006.1 | 37847 |
550 | CD 50 CAC>CTC [His>Leu] | Hb Dublin | NM_000558.5(HBA1):c.152A>T | α1 | Causative | α-chain variant | NG_000006.1 | 37848 |
2501 | CD 50 CAC>CAG [His>Gln] | Hb Frankfurt | HBA1:c.153C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37849 |
553 | CD 51 GGC>AGC [Gly>Ser] | Hb Riccarton | HBA1:c.154G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37850 |
2502 | CD 51 GGC>CGC [Gly>Arg] | Hb Russ | HBA1:c.154G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37850 |
375 | CD 51-55 (-13 bp deletion) | N/A | HBA1:c.155_167delGCTCTGCCCAGGT | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37851 |
556 | CD 52-59 (-24 bp) | Hb J-Biskra | HBA1:c.157_180del | α1 | Causative | α-chain variant | NG_000006.1 | 37853 |
3442 | CD 51-58 (+24 bp) | Hb Choisy | HBA1:c.157_180dupTCTGCCCAGGTTAAGGGCCACGGC | α1 | Causative | α-chain variant | NG_000006.1 | 37853 |
3560 | CD 52 TCT>TGT [Ser>Cys] | Hb Dongguan | HBA1:c.158C>G | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37854 |
4009 | CD53 GCC>ACC [Ala>Thr] (g.443 (GenBank MK600512.1)) | N/A | HBA1:c.160G>A | α1 | Causative | α-thalassaemia | NG_000006.1 | 37856 |
559 | CD 54 CAG>GAG [Gln>Glu] (Hb J-Paris-II, Hb Uppsala) | Hb Mexico | HBA1:c.163C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37859 |
560 | CD 54 CAG>CGG [Gln>Arg] (Hb Hikoshima) | Hb Shimonoseki | HBA1:c.164A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37860 |
2417 | CD 54 CAG>CGG [Gln>Arg] | Hb Shimonoseki | HBA1:c.164A>G | α1, α3.7 hybrid | Causative | α-thalassaemia | NG_000006.1 | 37860 |
3626 | CD 54 CAG>CAT [Gln>His] | Hb Goole | HBA1:c.165G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37861 |
561 | CD 55 GTT>CTT [Val>Leu] (Hb Poland) | Hb Roubaix | HBA1:c.166G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37862 |
562 | CD 55 GTT>GCT [Val>Ala] (Hb Gerland 1) | Hb Gerland | HBA1:c.167T>C | α1 | Causative | α-chain variant | NG_000006.1 | 37863 |
566 | CD 56 AAG>ACG [Lys>Thr] | Hb Thailand | HBA1:c.170A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37866 |
567 | CD 56 AAG>AAT or AAC [Lys>Asn] | Hb Belliard | HBA1:c.171G>C | HBA1:c.171G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37867 |
568 | CD 57 GGC>CGC [Gly>Arg] | Hb L-Persian Gulf | HBA1:c.172G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37868 |
3075 | CD 56/57 (+24bp) (HBA1:p.Lys57_Gly58insSerHisGlySerAlaGlnValLys , Hb KSVGH) | Hb Kaohsiung Veterans General Hospital | HBA1:c.171_172insAGCCACGGCTCTGCCCAAGTTAGG | α1 | Causative | α-chain variant | NG_000006.1 | 37868 |
3962 | CD 57 GGC>TGC [Gly>Cys] | Hb Kirikiriroa | HBA1:c.172G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37868 |
3175 | CD 58 CAC>CTC [His>Leu] | Hb Kirklareli | HBA1:c.176A>T | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37872 |
573 | CD 59 GGC>AGC [Gly>Ser] | Hb Parma | HBA1:c.178G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37874 |
3280 | CD 59 GGC>CGC [Gly>Arg] | Hb Zurich-Albisrieden | HBA1:c.178G>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37874 |
378 | CD 59 GGC>GAC [Gly>Asp] | Hb Adana | HBA1:c.179G>A | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37875 |
3624 | CD 60 AAG>GAG [Lys>Glu] | Hb Liuzhou | HBA1:c.182A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37878 |
578 | CD 60 AAG>AAT | Hb Zambia | HBA1:c.183G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37879 |
380 | CD 61 (-AAG) | Hb Clinic | HBA1:c.184_186del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37880 |
3334 | CD 61 AAG>TAG [Lys>STOP] | N/A | HBA1:c.184A>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37880 |
3717 | CD 61 AAG>-AG | N/A | HBA1:c.184del | α1 | Causative | α-thalassaemia | NG_000006.1 | 37880 |
2982 | CD 61 AAG>AGG [Lys>Arg] | Hb Derby | HBA1:c.185A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37881 |
582 | CD AAG>AAT [Lys>Asn] | Hb J-Buda | HBA1:c.186G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37882 |
381 | CD 62 (-GTG) [-Val] | Hb Aghia Sophia | HBA1:c.187_189del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37883 |
382 | CD 62 GTG>-TG | Hb Champaign | HBA1:c.187delG | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37883 |
2429 | CD 62 GTG>GCG [Val>Ala] | N/A | HBA1:c.188T>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37884 |
2347 | CD 62 -G | N/A | HBA1:c.189delG | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37885 |
3015 | CD 63 GCC>ACC [Ala>Thr] | Hb Greenville-NC | HBA1:c.190G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37886 |
585 | CD 63 GCC>GAC [Ala>Asp] (Hb J-Pontoise) | Hb Pontoise | NM_000558.5(HBA1):c.191C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37887 |
383 | CD 64-74 (-33 bp) | N/A | HBA1:c.193_225del33 | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37889 |
587 | CD 64 GAC>CAC [Asp>His] | Hb Q-India | HBA1:c.193G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37889 |
2528 | CD 64 GAC>AAC [Asp>Asn] (Hb Wädenswil, Hb Burgos) | Hb G-Waimanalo | HBA1:c.193G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37889 |
2455 | CD 64 GAC>GCC [Asp>Ala] | Hb Lucan | HBA1:c.194A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37890 |
3788 | CD 65 GCG>CCG [Ala>Pro] | Hb Maruchi | HBA1:c.196G>C | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37892 |
3373 | CD 67 ACC>-CC | N/A | HBA1:c.202delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37898 |
594 | CD 68 AAC>CAC [Asn>His] | Hb Jeddah | HBA1:c.205A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37901 |
597 | CD 68 +GCGCTGACCAAC [+Ala-Leu-Thr-Asn] | Hb Esch | HBA1:c.207_208insGCGCTGACCAAC | α1 | Causative | α-chain variant | NG_000006.1 | 37904 |
3755 | CD 69 GCC>GCT [Ala>Ala] | N/A | HBA1:c.210C>T | α1 | Neutral | N/A | NG_000006.1 | 37906 |
599 | CD 70 GTG>ATG [Val>Met] | Hb Haaksbergen | HBA1:c.211G>A | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37907 |
4007 | CD 70 GTG>TTG [Val>Leu] (g.494 (GenBank MK600512.1)) | N/A | HBA1:c.211G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37907 |
385 | CD 74/75 -GAC [- Asp] | N/A | HBA1:c.212_214delGAC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37908 |
2358 | CD 71 GCG>GTG [Ala>Val] (Hb Ozieri) | Hb Allison Park | HBA1:c.215C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37911 |
3312 | CD 72 CAC>CAG [His>Gln] | Hb Madonie | HBA1:c.219C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37915 |
4008 | CD 72 CAC>CA- (g.502 (GenBank: MK600512.1)) | N/A | HBA1:c.219delC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37915 |
2996 | CD 73 GTG>ATG [Val>Met] | Hb Argenteuil | HBA1:c.220G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37916 |
3326 | CD 73 GTG>G-G | N/A | HBA1:c.221delT | α1 | Causative | α-thalassaemia | NG_000006.1 | 37917 |
607 | CD 74 GAC>CAC [Asp>His] (Hb Asabara, Hb G-Taichung, Hb Kurashiki-I, Hb Mahidol) | Hb Q-Thailand | HBA1:c.223G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37919 |
3759 | CD 74 GAC>AAC [Asp>Asn] | Hb G-Pest | HBA1:c.223G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37919 |
3848 | -α4.2-Q-Thailand | N/A | N/A | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37919 |
608 | CD 74 GAC>GTC [Asp>Val] | Hb Les Lilas | HBA1:c.224A>T | α1 | Causative | α-chain variant | NG_000006.1 | 37920 |
609 | CD 74 GAC>GGC [Asp>Gly] | Hb Chapel Hill | HBA1:c.224A>G | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37920 |
3875 | CD 74 GAC>GAG [Asp>Glu] | Hb Jishui | HBA1:c.225C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37921 |
2503 | CD 75 GAC>TAC [Asp>Tyr] | Hb Winnipeg | HBA1:c.226G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37922 |
3760 | CD 75 GAC>AAC [Asp>Asn] | Hb Matsue-Oki | HBA1:c.226G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37922 |
2485 | CD 77 CCC>TCC [Pro>Ser] | Hb Nile | HBA1:c.232C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37928 |
2504 | CD 77 CCC>CAC [Pro>His] | Hb Toulon | HBA1:c.233C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37929 |
625 | CD 78 AAC>CAC [Asn>His] | Hb Davenport | HBA1:c.235A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37931 |
386 | CD 78 -C | N/A | HBA1:c.237delC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37933 |
2505 | CD 78 AAC>AAG [Asn>Lys] | Hb Stanleyville-II | HBA1:c.237C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37933 |
3897 | CD 78 AAC>AAA [Asn>Lys] | Hb Qinzhou | HBA1:c.237C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37933 |
4081 | CD 79 GCG>GTG [Ala>Val] | Hb Tangshan | HBA1:c.239C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37935 |
632 | CD 81 TCC>TGC [Ser>Cys] | Hb Nigeria | HBA1:c.245C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37941 |
387 | CD 82-84 (-9 bp) | N/A | HBA1:c.247_255del | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37943 |
633 | CD 82 GCC>ACC (Ala>Thr) | Hb Hagley Park | HBA1:c.247G>A | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37943 |
637 | CD 84 AGC>AGA [Ser>Arg] | Hb Etobicoke | HBA1:c.255C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37949 |
639 | CD 85 GAC>AAC [Asp>Asn] | Hb G-Norfolk | HBA1:c.256G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37952 |
641 | CD 85 GAC>CAC [Asp>His] | Hb Canuts | HBA1:c.256G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37952 |
2336 | CD 86 CTG>GTG [Leu>Val] | N/A | HBA1:c.259C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37955 |
4098 | CD 86 CTG>CCG [Leu>Pro] | Hb Thessaloniki | HBA1:c.260T>C | α1 | Causative | α-chain variant | NG_000006.1 | 37956 |
647 | CD 87 CAC>GAC [His>Asp] | Hb Bonn | HBA1:c.262C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37958 |
2506 | CD 87 CAC>TAC [His>Tyr] (Hb M-Kankakee , Hb M-Oldenburg , Hb M-Sendai) | Hb M-Iwate | HBA1:c.262C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37958 |
649 | CD 87 CAC>CCC [His>Pro] | Hb Grifton | HBA1:c.263A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37959 |
3861 | CD 87 (-A) | N/A | HBA1:c.263delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37959 |
3879 | CD 87 CAC>CTC [His>Leu] | Hb Padma River | HBA1:c.263A>T | α1 | Causative | α-chain variant | NG_000006.1 | 37959 |
3434 | CD 87 CAC>CAG [His>Gln] | Hb Lansing-Ramathibodi | HBA1:c.264C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37960 |
658 | CD 89 CAC>CAG [His>Gln] | Hb Buffalo | HBA1:c.270C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37966 |
3630 | CD 90 AAG>CAG [Lys>Gln] | Hb Luocheng | HBA1:c.271A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37967 |
662 | CD 90 AAG>AGG [Lys>Arg] | Hb Clinico Madrid II | HBA1:c.272A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37968 |
663 | CD 90 AAG>ACG | Hb J-Rajappen | HBA1:c.272A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37968 |
3756 | CD 90 AAG>AAC [Lys>Asn] | Hb J-Broussais | HBA1:c.273G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37969 |
3993 | CD 90 AAG>AAT [Lys>Asn] | Hb Guigang | HBA1:c.273G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37969 |
665 | CD 91 CTT>TTT [Leu>Phe] (Hb Grey Lynn) | Hb Vientiane | HBA1:c.274C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37970 |
668 | CD 92 CGG>CAG [Arg>Gln] | Hb J-Cape Town | HBA1:c.278G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37973 |
390 | CD 93-99 (+21 bp) | N/A | HBA1:c.280_300ins21 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37976 |
3852 | CD 93 GTG>ATG [Val>Met] | Hb Qingcheng | HBA1:c.280G>A | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37976 |
672 | CD 93 GTG>GCG [Val>Ala] | Hb Die | HBA1:c.281T>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37977 |
2507 | CD 94 GAC>AAC [Asp>Asn] | Hb Titusville | HBA1:c.283G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37979 |
2539 | IVS II-3 (+21bp) | Hb SKMC | HBA1:c.283_300+3dup | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37979 |
677 | CD 94 GAC>GCC [Asp>Ala] | Hb Bassett | HBA1:c.284A>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37980 |
678 | CD 94 GAC>GGC [Asp>Gly] | Hb Çapa | HBA1:c.284A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37980 |
681 | CD 95 CCG>ACG [Pro>Thr] | Hb Godavari | NM_000558.3(HBA1):c.286C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37982 |
684 | CD 95 CCG>CGG [Pro>Arg] | Hb St. Luke's | HBA1:c.287C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37983 |
685 | CD 95 CCG>CAG [Pro>Gln] | Hb Wichita | HBA1:c.287C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37983 |
3718 | CD 95 CCG>CTG [Pro>Leu] | Hb Georgia | HBA1:c.287C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37983 |
4093 | CD 95 (-C) | Hb Campania | HBA1:c.287delC | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37983 |
2357 | CD 96 GTC>CTC [Val>Leu] | Hb Woodstock | HBA1:c.289G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37985 |
3914 | CD 97 AAC>AGC [Asn>Ser] | Hb Northwood | HBA1:c.293A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37989 |
690 | CD 99 AAG>GAG [Lys>Glu] (Hb Turriff-I) | Hb Turriff | NM_000558.5(HBA1):c.298A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37994 |
2467 | CD 99 AAG>TAG | N/A | HBA1:c.298A>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37994 |
691 | CD 99 AAG>AAT [Lys>Asn] (Hb Harlow) | Hb Beziers | HBA1:c.300G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37996 |
3031 | IVS II-1 G>A | N/A | HBA1:c.300+1G>A | α1 | Causative | α-thalassaemia | NG_000006.1 | 37997 |
3736 | IVS II-55 G>T | N/A | HBA1:c.300+55G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 38051 |
3737 | IVS II-58 G>A | N/A | HBA1:c.300+58G>A | α1 | Causative | α-thalassaemia | NG_000006.1 | 38054 |
4005 | IVS II-96 G>C (g.679 (GenBank MK600512.1)) | N/A | HBA1:c.300+96G>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 38092 |
4042 | IVS II-2 (-8 bp, +1 bp) | N/A | HBA1:c.301-31_301-24delinsG | α1 | Causative | α-thalassaemia | NG_000006.1 | 38115 |
3738 | IVS II-141 T>C | N/A | HBA1:c.301-9T>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 38137 |
2222 | IVS II-147 C>G | N/A | HBA1:c.301-3C>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38143 |
393 | IVS II-148 A>G consensus | N/A | HBA1:c.301-2A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38144 |
2303 | CD 100 CTC>TTC (Leu>Phe) | Hb Weesp | HBA1:c.301C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38146 |
2305 | CD 100 CTC>CCC [Leu>Pro] | Hb Corsica | HBA1:c.302T>C | α1 | Causative | α-chain variant | NG_000006.1 | 38147 |
2985 | CD 102 AGC>CGC [Ser>Arg] | Hb Manitoba IV | HBA1:c.307A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38152 |
693 | CD 102 AGC>AGA [Ser>Arg] | Hb Manitoba II | HBA1:c.309C>A | α1 | Causative | α-chain variant | NG_000006.1 | 38154 |
695 | CD 103 CAC>TAC [His>Tyr] | Hb Charolles | HBA1:c.310C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38155 |
2532 | CD 103 CAC>GAC [His>Asp] | Hb Illinois | HBA1:c.310C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38155 |
395 | CD 104 TGC>AGC [Cys>Ser] | Hb Oegstgeest | HBA1:c.313T>A | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38158 |
3956 | CD 104 TGC>TAC [Cys>Tyr] | Hb Sallanches | HBA1:c.314G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38159 |
2340 | CD 104 TGC>TGG [Cys>Trp] | Hb Donnington | HBA1:c.315C>G | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38160 |
701 | CD 106 CTG>CCG [Leu>Pro] | Hb Charlieu | HBA1:c.320T>C | α1 | Causative | α-chain variant | NG_000006.1 | 38165 |
2315 | CD 110 GCC>GTC [Ala>Val] (Hb White Rose) | Hb Montluel | HBA1:c.332C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38177 |
2224 | CD 110-114 (-13 bp) | N/A | HBA1:c.333_345delCGCCCACCTCCCC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38178 |
708 | CD 112 CAC>GAC [His>Asp] | Hb Hopkins-II | NM_000558.5(HBA1):c.337C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38182 |
2377 | CD 112 CAC>CAA [His>Gln] | Hb West Allis | HBA1:c.339C>A | α1 | Causative | α-chain variant | NG_000006.1 | 38184 |
2316 | CD 114 CCC>GCC [Pro>Ala] | Hb Broomhill | NM_000558.5(HBA1):c.343C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38188 |
715 | CD 114 CCC>CTC [Pro>Leu] | Hb Nouakchott | NM_000558.3(HBA1):c.344C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38189 |
3378 | CD 114 CCC>CAC [Pro>His] | Hb Hubei | HBA1:c.344C>A | α1 | Causative | α-chain variant | NG_000006.1 | 38189 |
2322 | CD 115 GCC>GTC [Ala>Val] | Hb Palmela | HBA1:c.347C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38192 |
720 | CD 116 GAG>AAG [Glu>Lys] (Hb Buginese-X, Hb Oliviere) | Hb O-Indonesia | HBA1:c.349G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38194 |
723 | CD 118-119 +9 bp [+Glu-Phe-Thr] (Hb Dakar) | Hb Grady | HBA1:c.349_357dup | α1 | Causative | α-chain variant | NG_000006.1 | 38194 |
3864 | CD 116 GAG>TAG [Glu>Stop] | N/A | HBA1:c.349G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 38194 |
719 | CD 116 GAG>GCG [Glu>Ala] | Hb Ube-4 | HBA1:c.350A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38195 |
724 | CD 117/118 +ATC [+Ile] | Hb Phnom Penh | HBA1:c.354_355insATC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38199 |
3036 | CD 117/118 +TCA [+Ser] | Hb Wexham | HBA1:c.354_355insTCA | α1 | Causative | α-chain variant | NG_000006.1 | 38199 |
406 | CD 119 CCT>TCT [Pro>Ser] (Hb Bemalda P, Hb Bernalda) | Hb Groene Hart | HBA1:c.358C>T | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38203 |
726 | CD 119 CCT>CTT [Pro>Leu] | Hb Diamant | HBA1:c.359C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38204 |
2508 | CD 120 GCG>GAG [Ala>Glu] (Hb J-Birmingham) | Hb J-Meerut | HBA1:c.362C>A | α1 | Causative | α-chain variant | NG_000006.1 | 38207 |
728 | CD 121 GTG>ATG [Val>Met] | Hb Owari | HBA1:c.364G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38209 |
729 | CD 122 CAC>TAC [His>Tyr] | Hb Yanase | HBA1:c.367C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38212 |
3751 | CD 122 CAC>GAC [His>Asp] | Hb Daxin | HBA1:c.367C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38212 |
407 | CD 123 GCC >CCC [Ala>Pro] | Hb Voreppe | HBA1:c.370G>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38215 |
733 | CD 123 GCC>TCC [Ala>Ser] | Hb Mulhacen | HBA1:c.370G>T | α1 | Causative | α-chain variant | NG_000006.1 | 38215 |
3016 | CD 123 GCC>GTC [Ala>Val] | Hb Louisa | HBA1:c.371C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38216 |
2984 | CD124 TCC>TGC [Ser>Cys] | Hb Harehills | HBA1:c.374C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38219 |
2414 | CD 125 CTG>CCG [Leu>Pro] | Hb Quong Sze II | HBA1:c.377T>C | α1 | Causative | α-chain variant | NG_000006.1 | 38222 |
738 | CD 126 GAC>CAC [Asp>His] | Hb Sassari | HBA1:c.379G>C | α1 | Causative | α-chain variant | NG_000006.1 | 38224 |
739 | CD 126 GAC>TΑC [Asp>Tyr] | Hb Montefiore | HBA1:c.379G>T | α1, α1 or α2 | Causative | α-chain variant | NG_000006.1 | 38224 |
2408 | CD 126 GAC>GCC [Asp>Ala] | Hb Verdun | HBA1:c.380A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38225 |
743 | CD 126 GAC>GAG [Asp>Glu] | Hb Burlington | HBA1:c.381C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38226 |
3380 | CD 127 AAG>GAG [Lys>Glu] | Hb Shantou | HBA1:c.382A>G | α1 | Causative | α-chain variant | NG_000006.1 | 38227 |
3789 | CD 127 AAG>CAG [Lys>Gln] | Hb Waikato | HBA1:c.382A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38227 |
411 | CD 129 CTG>CCG [Leu>Pro] | Hb Tunis-Bizerte | NM_000558.3(HBA1):c.389T>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38234 |
749 | CD 130 GCT>GTT [Ala>Val] | Hb Westborough | HBA1:c.392C>T | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 38237 |
3281 | CD 130 (+T) | Hb Sichuan | HBA1:c.393_394insT | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38238 |
752 | CD 131 TCT>TTT | Hb Lusaka | HBA1:c.395C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38240 |
416 | CD 131 (+T) >175aa | Hb Pak Num Po | HBA1:c.396dup | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38241 |
753 | CD 131 TCT>TC- | Hb Fez | HBA1:c.396delT | α1 | Causative | α-chain variant | NG_000006.1 | 38241 |
3695 | CD 131 TCT>TCC [Ser>Ser] | N/A | HBA1:c.396T>C | α1 | Neutral | N/A | NG_000006.1 | 38241 |
2323 | CD 132 GTG>ATG [Val>Met] | Hb Portimão | HBA1:c.397G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38242 |
3723 | CD 132 GTG>GCG [Val>Ala] | N/A | HBA1:c.398T>C | α1 | Causative | α-chain variant | NG_000006.1 | 38243 |
4084 | CD 133-135 (-7 bp, -GCACCGT) | N/A | HBA1:c.401_407del | α1 | Causative | α-thalassaemia | NG_000006.1 | 38246 |
760 | CD 134 -C | Hb Senlis | HBA1:c.404delC | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 38249 |
762 | CD 135 GTG>CTG [Val>Met] | Hb Trenton | HBA1:c.406G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38251 |
3724 | CD 136 CTG>CAG [Leu>Gln] | N/A | HBA1:c.410T>A | α1 | Causative | α-chain variant | NG_000006.1 | 38255 |
767 | CD 137 ACC>CCC [Thr>Pro] | Hb Verona | HBA1:c.412A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38257 |
3802 | CD 138 TCC>GCC [Ser>Ala] | Hb Paynesville | HBA1:c.415T>G | α1 | Causative | α-chain variant | NG_000006.1 | 38260 |
769 | CD 138 TCC>TGC [Ser>Cys] | Hb Ecuador | HBA1:c.416C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38261 |
771 | CD 139 AAA>GAA [Ala>Glu] | Hb Hanamaki-1 | HBA1:c.418A>G | α1 | Causative | α-chain variant | NG_000006.1 | 38263 |
4017 | CD 139 AAA>TAA [Lys>STOP] (Tenerife) | Hb Nivaria | HBA1:c.418A>T | α1 | Causative | α-chain variant | NG_000006.1 | 38263 |
773 | CD 139 AAA>ACA [Lys>Thr] | Hb Tokoname | NM_000558.5(HBA1):c.419A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38264 |
776 | CD 140 TAC>CAC [Tyr>His] | Hb Ethiopia | NM_000558.5(HBA1):c.421T>C | α1 | Causative | α-chain variant | NG_000006.1 | 38266 |
3972 | CD 140 TAC>TAA [Tyr>STOP] | Hb Natal | HBA1:c.423C>A | α1 | Causative | α-chain variant | NG_000006.1 | 38268 |
779 | CD 141 CGT>GGT [Arg>Gly] | Hb J-Camagüey | NM_000558.3(HBA1):c.424C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38269 |
782 | CD 141 CGT>CTT [Arg>Leu] | Hb Legnano | HBA1:c.425G>T | α1 | Causative | α-chain variant | NG_000006.1 | 38270 |
783 | CD 141 CGT>CAT [Arg>His] | Hb Suresnes | NM_000558.3(HBA1):c.425G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38270 |
3302 | 3'UTR +46 C>A | N/A | HBA1:c.*46C>A | α1 | Causative | α-thalassaemia | NG_000006.1 | 38320 |
2225 | Poly A (G>A) AATAAAG>AATAAAA | N/A | HBA1:c.*96G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38370 |
3739 | TTS +23 (+T) | N/A | HBA1:c.*134_*135insT | α1 | Causative | α-thalassaemia | NG_000006.1 | 38408 |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-10-23 15:23:06