IthaID: 2502

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: CD 51 GGC>CGC [Gly>Arg] HGVS Name: HBA1:c.154G>C
Hb Name: Hb Russ Protein Info: α1 51(CE9) Gly>Arg
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTTCCCGCACTTCGACCTGAGCCAC [C/G] GCTCTGCCCAGGTTAAGGGCCACGG (Strand: +)

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37850
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: American, Caucasian, Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

HPLC

Disclaimer: The HPLC images are provided as an information resource only. Bio-Rad Laboratories, Inc and the ITHANET Portal disclaim responsibility and have no liability if this information is used for diagnostic or treatment purposes. D-10™ and VARIANT™ are registered trademarks of Bio-Rad Laboratories, Inc. and used with permission. Redistribution and use of the above material is allowed only with permission by Bio-Rad Laboratories, Inc. To access HPLC images and reports for different variants, use the IthaChrom tool.
ID Hb Variant Gene Instrument Method Area (%) Ret Time (min) Comments
137Hb Russα1D-10Dual Kit Program15.34.09Heterozygous. Elutes in HbS window. Clinically normal. [PDF]
138Hb Russα1VARIANTβ-thal Short Program15.74.18Heterozygous. Elutes in HbS window. Clinically normal.[PDF]
139Hb Russα1VARIANT IIβ-thal Short Program15.14.32Heterozygous. Elutes in HbS window. Clinically normal.[PDF]
140Hb Russα1VARIANT IIDual Kit Program163.483Heterozygous. Elutes in HbS window. Clinically normal.[PDF]

In silico pathogenicity prediction

Publications / Origin

  1. Molchanova TP, Pobedimskaya DD, Huisman TH, The differences in quantities of alpha 2- and alpha 1-globin gene variants in heterozygotes., Br. J. Haematol. , 88(2), 300-6, 1994
  2. Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009
Created on 2014-06-05 11:04:14, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.