IthaID: 2506

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 87 CAC>TAC [His>Tyr] HGVS Name: HBA1:c.262C>T
Hb Name: Hb M-Iwate Protein Info: α1 87(F8) His>Tyr
Also known as: Hb M-Kankakee , Hb M-Oldenburg , Hb M-Sendai

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CGCGCTGTCCGCCCTGAGCGACCTG [A/C/G/T] ACGCGCACAAGCTTCGGGTGGACCC (Strand: +)

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:Methemoglobinaemia
Stability: N/A
Oxygen Affinity: Decreased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37958
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Japanese, Irish, German, Turkish, Romanian, Scottish, Caucasian, African-American
Molecular mechanism: Altered heme pocket
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Konigsberg W, Lehmann H, The amino acid substitution in hemoglobin M-Iwate., Biochim. Biophys. Acta , 107(2), 266-9, 1965
  2. Sjöquist J, Heterogeneity of heavy (gamma) chain preparations from human gamma G-immunoglobulins., Nature , 210(5041), 1182-3, 1966
  3. Jones RT, Coleman RD, Heller P, The structural abnormality of hemoglobin M Kankakee., J. Biol. Chem. , 241(9), 2137-43, 1966
  4. Ozsoylu S, Congenital methemoglobinemia due to hemoglobin M., Acta Haematol. , 47(4), 225-32, 1972
  5. Trittelvitz E, Gersonde K, Winterhalter KH, Electron-spin resonance of nitrosyl haemoglobins: normal alpha and beta chains and mutants Hb M Iwate and Hb Zürich., Eur. J. Biochem. , 51(1), 33-42, 1975
  6. Horst J, Assum G, Griese EU, Eigel A, Hampl W, Kohne E, Hemoglobin M Iwate is caused by a C----T transition in codon 87 of the human alpha 1-globin gene., Hum. Genet. , 75(1), 53-5, 1987
  7. Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009
Created on 2014-06-05 11:57:56, Last reviewed on 2015-12-03 14:44:03 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.