IthaID: 2506
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 87 CAC>TAC [His>Tyr] | HGVS Name: | HBA1:c.262C>T |
| Hb Name: | Hb M-Iwate | Protein Info: | α1 87(F8) His>Tyr |
Context nucleotide sequence:
CGCGCTGTCCGCCCTGAGCGACCTG [A/C/G/T] ACGCGCACAAGCTTCGGGTGGACCC (Strand: +)
Also known as: Hb M-Kankakee , Hb M-Oldenburg , Hb M-Sendai
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | Methemoglobinaemia |
| Stability: | N/A |
| Oxygen Affinity: | Decreased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37958 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Japanese, Irish, German, Turkish, Romanian, Scottish, Caucasian, African-American |
| Molecular mechanism: | Altered heme pocket |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Konigsberg W, Lehmann H, The amino acid substitution in hemoglobin M-Iwate., Biochim. Biophys. Acta , 107(2), 266-9, 1965
- Sjöquist J, Heterogeneity of heavy (gamma) chain preparations from human gamma G-immunoglobulins., Nature , 210(5041), 1182-3, 1966
- Jones RT, Coleman RD, Heller P, The structural abnormality of hemoglobin M Kankakee., J. Biol. Chem. , 241(9), 2137-43, 1966
- Ozsoylu S, Congenital methemoglobinemia due to hemoglobin M., Acta Haematol. , 47(4), 225-32, 1972
- Trittelvitz E, Gersonde K, Winterhalter KH, Electron-spin resonance of nitrosyl haemoglobins: normal alpha and beta chains and mutants Hb M Iwate and Hb Zürich., Eur. J. Biochem. , 51(1), 33-42, 1975
- Horst J, Assum G, Griese EU, Eigel A, Hampl W, Kohne E, Hemoglobin M Iwate is caused by a C----T transition in codon 87 of the human alpha 1-globin gene., Hum. Genet. , 75(1), 53-5, 1987
- Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009
Created on 2014-06-05 11:57:56,
Last reviewed on 2015-12-03 14:44:03 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.