IthaID: 2508

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Benign / Likely Benign
Common Name: CD 120 GCG>GAG [Ala>Glu] HGVS Name: HBA1:c.362C>A
Hb Name: Hb J-Meerut Protein Info: α1 120(H3) Ala>Glu
Also known as: Hb J-Birmingham

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CACCTCCCCGCCGAGTTCACCCCTG [A/C] GGTGCACGCCTCCCTGGACAAGTTC (Strand: +)

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 38207
Size: 1 bp
Located at: α1
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Indian, Japanese, Turkish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Blackwell RQ, Wong HB, Wang CL, Weng MI, Liu CS, Hemoglobin J Meerut: alpha120 Ala leads to Glu., Biochim. Biophys. Acta , 351(1), 7-12, 1974
  2. Harano T, Harano K, Imai K, Yunoki H, Yagi H, Nagashima K, Kuroume T, Hb J-Meerut [alpha 120(H3)Ala----Glu] found in a Japanese family., Hemoglobin , 13(2), 169-75, 1989
  3. Molchanova TP, Pobedimskaya DD, Huisman TH, The differences in quantities of alpha 2- and alpha 1-globin gene variants in heterozygotes., Br. J. Haematol. , 88(2), 300-6, 1994
  4. Yalçin A, Avcu F, Beyan C, Gürgey A, Ural AU, A case of HB J-Meerut (or Hb J-Birmingham) [alpha 120(H3)Ala-->Glu]., Hemoglobin , 18(6), 433-5, 1994
  5. Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009
Created on 2014-06-05 12:23:26, Last reviewed on 2024-02-13 12:34:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.