IthaID: 2576

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 68 AAC>A-C HGVS Name: HBA2:c.206delA
Hb Name: N/A Protein Info: α2 68(E17) Asn>Thr fs*16
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CAAGAAGGTGGCCGACGCGCTGACCA [A/-] CGCCGTGGCGCACGTGGACGACAT (Strand: +)

Comments: This is an α+-thalassaemia mutation, no abnormal haemoglobin is visible on HPLC or CE. It was found in heterozygous form in a Dutch woman of presumably Asian origin (Surinamese-Indonesian).

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34098
Size: 1 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Surinamese, Indonesian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1L. Harteveld, Cornelis2016-03-02First report.
Created on 2016-05-06 14:37:51, Last reviewed on 2022-09-21 12:50:30 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.