IthaID: 3025



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -114 C>G HGVS Name: HBG1:c.-167C>G
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
ATGGGTTGGCCAGCCTTGCCTTGAC [C>G] AATAGCCTTGACAAGGCAAACTTGA (Strand: +)

Also known as: African-American/Hispanic non-deletional HPFH

Comments: Subject presented with Hb S-beta(+) thalassaemia and elevated HbF. Disrupts binding site (TGACCA) of BCL11A transcriptional repressor.

External Links

No available links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47645
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African American/Hispanic
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Akinbami AO, Campbell AD, Han ZJ, Luo HY, Chui DH, Steinberg MH, Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease., Hemoglobin , 40(1), 64-5, 2016 PubMed
Created on 2016-08-26 08:50:44, Last reviewed on 2020-10-08 13:47:58 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.