IthaID: 3269

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 147 TGA>CGA [Stop>Arg] HGVS Name: HBD:c.442T>C
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GCCCTGGCTCACAAGTACCAT [T>C] GAGATCCTGGACTGTTTCCTG (Strand: -)

Comments: The mutation results in the synthesis of a longer polypeptide by 15 amino acids before the new stop codon is reached. Possibly removed by mechanisms for the degradation of aberrant proteins. Detected in a molecular diagnostics laboratory in Italy.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:δ0
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 64650
Size: 1 bp
Located at: δ
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Italian, Tunisian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Cassarà F, Vinciguerra M, Cannata M, Marchese G, Passarello C, Leto F, Maggio A, Giambona A, Phenotypic Evaluation of a Novel Nucleotide Substitution (HBD: c.442T>C) on the δ-Globin Gene., Hemoglobin , 41(3), 220-222, 2017
  2. Di Bella C, Pugliatti F, La Rosa MA, Cara S, Capra AP, Rigoli L, A Novel Mutation of the δ-Globin Gene in an Asymptomatic 30-Year-Old Female., Acta Haematol., 139(1), 33-34, 2018
  3. Kasmi C, Amri Y, Hadj-Fredj S, Oueslati S, Dabboussi M, Mahjoub R, Hammami S, Aljane I, Mami FB, Jamoussi H, Messaoud T, Bibi A, Analysis of δ-globin gene alleles in Tunisians: description of three new delta-thalassemia mutations., Mol Biol Rep, 48(8), 5923-5933, 2021
Created on 2017-10-02 18:50:57, Last reviewed on 2021-10-12 12:14:46 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.