IthaID: 3332



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs4025935 HGVS Name: NG_009246.1:g.4023_4024delTG

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AAGGTATATATGCTCTGGAAAACTT [-/TG] TAATATTGAGTTGGTCTGGTGGTAA (Strand: +)

Comments: The GSTM1 null genotype (rs4025935) associated with HbA1 and HbS levels in sickle cell disease patients from Saudi Arabia [PMID: 27885941]. It is a predisposing factor for cardiac iron overload in β-thalassaemia major patients with low body iron as assessed by lifelong serum ferritin levels [PMID: 18477036]. It associated with significantly shorter cardiac MRI T2* values (hence, cardiac iron overload) independent of serum ferritin levels in Egyptian patients with β-thalassaemia major [PMID: 26288192].

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Cardiac iron load
Anaemia [HP:0001903]

Location

Chromosome: 1
Locus: NG_009246.1
Locus Location: 4023
Size: 2 bp
Located at: GSTM1
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Saudi, Egyptian, Sardinian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Origa R, Satta S, Matta G, Galanello R, Glutathione S-transferase gene polymorphism and cardiac iron overload in thalassaemia major., Br. J. Haematol. , 142(1), 143-5, 2008 PubMed
  2. Mokhtar GM, Sherif EM, Habeeb NM, Abdelmaksoud AA, El-Ghoroury EA, Ibrahim AS, Hamed EM, Glutathione S-transferase gene polymorphism: Relation to cardiac iron overload in Egyptian patients with Beta Thalassemia Major., Hematology , 21(1), 46-53, 2016 PubMed
  3. Abu-Duhier F, Mir R, GSTT1 (rs4025935) null genotype is associated with increased risk of sickle cell disease in the populations of Tabuk-Northwestern region of Saudi Arabia., Hematology , 2016 PubMed
Created on 2018-05-03 19:59:26, Last reviewed on 2019-12-23 12:04:04 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.