
IthaID: 3431
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | IVS I-38 C>T | HGVS Name: | HBA1:c.95+38C>T |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCCCTGCTCCGACCCGGGCTCCTCG [C>T] CCGCCCGGACCCACAGGCCACCCTC (Strand: +)
Comments: Detected together with CD 19 (-G) [ithaID=2465] in an Iranian subject with elevated Hb Bart's levels. The effect of this mutation on HBA1 gene expression is unclear as no regulatory sites seem to be involved. No mRNA analysis was performed to determine whether this mutation affects the α-gene expression or is merely a polymorphism.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | Unclear |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 37712 |
Size: | 1 bp |
Located at: | α1 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Iranian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Harteveld CL, Yavarian M, Zorai A, Quakkelaar ED, van Delft P, Giordano PC, Molecular spectrum of alpha-thalassemia in the Iranian population of Hormozgan: three novel point mutation defects., American journal of hematology, 74(2), 99-103, 2003
Created on 2019-05-29 16:49:10,
Last reviewed on 2019-05-29 17:15:37 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.