IthaID: 3445
Names and Sequences
Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | IVS I-13 G>T | HGVS Name: | HBB:c.92+13G>T |
Context nucleotide sequence:
GCCCTGGGCAGGTTGGTATCAAG [G/T] TTACAAGACAGGTTTAAGGAGAC (Strand: -)
Also known as:
Comments: This mutation is an innocuous SNP associated with a well-characterised cryptic splice donor site in HBB. The cryptic splice donor is activated by mutations IthaID 101, 102, 103, 107 and 111, leading to aberrant splicing, inclusion of intronic material in the HBB mRNA and beta-thalassaemia. Mutations IthaID 107 and 111 retain residual normal splicing activity, and in their presence this SNP may thus conceivably increase normal splicing and ameliorate the associated phenotype.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Allele Phenotype: | Neutral |
---|---|
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70699 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Treisman R, Orkin SH, Maniatis T, Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes., Nature, 302(5909), 591-6, 1983 PubMed
Created on 2019-09-23 12:41:56,
Last reviewed on 2020-09-28 16:56:43 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2019-09-23 12:41:56 | The IthaGenes Curation Team | Created |
2 | 2020-09-28 16:56:43 | The IthaGenes Curation Team | Reviewed. Inheritance added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2025-01-16 12:07:33