You are here:  
  1. Home
  2. Databases & Tools
  3. IthaGenes

IthaID: 3576



Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: rs10768683 HGVS Name: NG_000007.3:g.71055G>C

Context nucleotide sequence:
AACTTCAGGGTGAGTCTATGGGAC [G>C] CTTGATGTTTTCTTTCCCCTTCTTTTC (Strand: -)

Also known as: IVS II-16 G>C, HBB:c.315+16G>C

Comments: Variant identifies the polymorphic site AvaII in the beta-globin gene cluster that is used in the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian). It has been included on SNP chips to infer β-haplotypes [PMID: 18829352, 28800727, 23606168] and to develop a fetal haplotype phase strategy for the NIPD of beta-thalassaemia [PMID: 22896714]. It has been found in a heterozygous and homozygous state in a normal healthy population from urban eastern India [PMID: 24099628], as well as in Mohajir families from Pakistan [PMID: 22392582].

External Links

HbVar dbSNP
ClinVar

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71055
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American, Indian, Pakistani
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Liu L, Muralidhar S, Singh M, Sylvan C, Kalra IS, Quinn CT, Onyekwere OC, Pace BS, High-density SNP genotyping to define beta-globin locus haplotypes., Blood Cells Mol. Dis. , 42(1), 16-24, 2009 PubMed
  2. Lam KW, Jiang P, Liao GJ, Chan KC, Leung TY, Chiu RW, Lo YM, Noninvasive prenatal diagnosis of monogenic diseases by targeted massively parallel sequencing of maternal plasma: application to β-thalassemia., Clin. Chem. , 58(10), 1467-75, 2012 PubMed
  3. Moatter T, Kausar T, Aban M, Ghani S, Pal JA, Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population., Int. J. Hematol. , 95(4), 394-8, 2012 PubMed
  4. Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013 PubMed
  5. Sahoo SS, Biswal S, Dixit M, Distinctive mutation spectrum of the HBB gene in an urban eastern Indian population., Hemoglobin , 38(1), 33-8, 2014 PubMed
  6. Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017 PubMed
Created on 2020-03-10 15:53:25, Last reviewed on 2020-04-22 12:27:46 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2023-03-22 16:46:31