
IthaID: 3602
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -44 G>A | HGVS Name: | HBD:c.-94G>A |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCAACCTGCTCACTGGAGCAGGGA [G>A] GACAGGACCAGCATAAAAGGCAG (Strand: -)
Comments: Initially reported in an α+ thalassaemia carrier (-α4.2/αα) with a low level of HbA2 (1.12%) during an epidemiological survey in a student cohort, Guangxi Zhuang Autonomous Region. Reported as a compound heterozygote with δ -77 T>C with a slightly decreased hematological parameters (Hb 115 g/L, MCV 79.2 fL, MCH 25.3 pg, RDW 15.3%, HbA2 0.8%, and SF 15.40 ng/mL), which might be due to the lower level of SF.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | δ-thalassaemia |
| Allele Phenotype: | δ+ |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 63089 |
| Size: | 1 bp |
| Located at: | δ |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Xiong F, Sun M, Zhang X, Cai R, Zhou Y, Lou J, Zeng L, Sun Q, Xiao Q, Shang X, Wei X, Zhang T, Chen P, Xu X, Molecular epidemiological survey of haemoglobinopathies in the Guangxi Zhuang Autonomous Region of southern China., Clin. Genet., 78(2), 139-48, 2010
- Chen M, Huang H, Chen L, Lin N, Zhang M, Lin Y, Xu L, First report of the spectrum of δ-globin gene mutations among women of reproductive age in Fujian area-Discrimination of δ-thalassemia, α-thalassemia, and Iron Deficiency Anemia., J Clin Lab Anal, 34(11), e23479, 2020
Created on 2020-07-01 13:49:27,
Last reviewed on 2021-08-17 14:11:27 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.