IthaID: 3634



Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: N/A
Common Name: IVS II-202 T>A HGVS Name: HBB:c.315+202T>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTTTCTTTTGTTTAATTCTTGCT [T>A] TCTTTTTTTTTCTTCTCCGCAA (Strand: -)

Comments: Reported as a neutral polymorphism; found in a homozygous state in a subject with beta-thalassaemia. No genotype information given.

External Links

No available links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71241
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Jalilian M, Azizi Jalilian F, Ahmadi L, Amini R, Esfehani H, Sosanian M, Rabbani B, Maleki M, Mahdieh N, The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran., Hemoglobin, 41(1), 61-64, 2017 PubMed
Created on 2020-09-28 16:30:31, Last reviewed on 2020-09-28 17:01:06 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.