IthaID: 365
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 31 AGG>--G | HGVS Name: | HBA2:c.94_95del |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TGGTGCGGAGGCCCTGGAG [AG/-] GTGAGGCTCCCTCCCCTGCT (Strand: +)
Also known as:
Comments: Found in cis with -α3.7 [IthaD:300] in an American Black male presented with mild hypochromic microcytic anaemia consistent with α-thalassaemia trait. The 2 bp deletion in the context of a −α3.7 thalassaemia chromosome reported in association with Hb G-Philadelphia [IthaID:596] in his mother presented with the typical phenotype of Hb H disease.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α⁺ |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 33869 |
Size: | 2 bp |
Located at: | α2 |
Specific Location: | Exon 1 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | American Black |
Molecular mechanism: | Altered α1β1 interface |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Rieder RF, Woodbury DH, Rucknagel DL, The interaction of alpha-thalassaemia and haemoglobin G Philadelphia., Br J Haematol, 32(2), 159-65, 1976 PubMed
- Sancar GB, Tatsis B, Cedeno MM, Rieder RF, Proportion of hemoglobin G Philadelphia (alpha 268 Asn leads to Lys beta 2) in heterozygotes is determined by alpha-globin gene deletions., Proc Natl Acad Sci U S A, 77(11), 6874-8, 1980 PubMed
- Safaya S, Rieder RF, Dysfunctional alpha-globin gene in hemoglobin H disease in blacks. A dinucleotide deletion produces a frameshift and a termination codon., The Journal of biological chemistry, 263(9), 4328-32, 1988 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-02-25 18:10:26 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-06-04 10:45:19 | The IthaGenes Curation Team | Reviewed. HbVar link added. |
4 | 2014-06-04 10:46:27 | The IthaGenes Curation Team | Reviewed. Variation size corrected. |
5 | 2014-10-20 10:02:20 | The IthaGenes Curation Team | Reviewed. |
6 | 2022-02-25 17:42:27 | The IthaGenes Curation Team | Reviewed. HGVS and allele phenotype corrected. Comment and references added. |
7 | 2022-02-25 18:03:24 | The IthaGenes Curation Team | Reviewed. Affected gene corrected. |
8 | 2022-02-25 18:10:26 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2023-03-22 16:46:31