
IthaID: 3697
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 147 TAA>ΑAA [Stop>Lys] | HGVS Name: | HBB:c.442T>A |
| Hb Name: | Hb Mokum | Protein Info: | β 147, Stop>Lys; modified C-terminal sequence: (147)Lys-Ala-Arg-Phe-Leu-Ala-Val-Gln-Phe-Leu-Leu- Lys-Val-Pro-Leu-Phe-Pro-Lys-Ser-Asn-(167)Tyr-COOH |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTAATGCCCTGGCCCACAAGTATCAC [T/A] AAGCTCGCTTTCTTGCTGTCCAATTT (Strand: -)
Comments: Reported as a de novo mutation in a patient with hemolytic anaemia, leading to dominant β-thalassaemia state. The mutation results in a stop-codon substitution to a lysine residue and an increase of 21 amino-acids in the β-globin chain.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72016 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Nonsense codon (Translation) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Valeria Rizzuto, Tamara T Koopmann, Adoración Blanco-Álvarez, Barbara Tazón-Vega, Amira Idrizovic, Cristina Díaz de Heredia, Rafael Del Orbe, Miriam Vara Pampliega, Pablo Velasco, David Beneitez, Gijs W E Santen, Quinten Waisfisz, Mariet Elting, Frans J W Smiers, Anne J de Pagter, Jean-Louis H Kerkhoffs, Cornelis L Harteveld, Maria Del Mar Mañú-Pereira, doi: 10.3389/fphys.2021.628236. eCollection 2021. Usefulness of NGS for Diagnosis of Dominant Beta-Thalassemia and Unstable Hemoglobinopathies in Five Clinical Cases, Frontiers in Physiology, 12(0), 0, 2021
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | L. Harteveld, Cornelis | 2020-11-11 | First report. |
Created on 2020-11-11 11:41:12,
Last reviewed on 2021-06-03 09:32:24 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.