Loading... Please wait!
Quick filtering
IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
---|---|---|---|---|---|---|---|---|
291 | Czech (4237 bp deletion) | N/A | NG_000007.3:g.67258_71501del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
293 | Cape Verdean | N/A | NG_000007.3:g.71548_79271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
294 | Asian Indian (10329 bp deletion) | N/A | NG_000007.3:g.(67531_67533)_(77874_77876)del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
295 | Australian (Anglo Saxon) (12023 bp deletion) | N/A | NC_000011.10:g.5215894_5227926del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
299 | Italian (~67 kb deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
2123 | 7719 bp deletion | N/A | NG_000007.3:g.71550_79270del7719 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
3935 | 12.4 kb Mediterranean deletion | N/A | NG_000007.3:g.2798_15161delinsAGAGCCCT | βLCR | Causative | β-thalassaemia | NG_000007.3 | 2798 |
3483 | CD 121 GAA>-AA | Hb Mahasarakham | HBB:c.364delG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 6394 |
2566 | Caribbean | N/A | NG_000007.3:g.8510_13369del | βLCR | Causative | β-thalassaemia | NG_000007.3 | 8510 |
2479 | Toledo (1992 bp deletion) | N/A | NG_000007.3:g.11835_13826del | βLCR | Causative | β-thalassaemia | NG_000007.3 | 11835 |
3869 | >29.5 Kb duplication | N/A | NG_000007.3:g.(27675_41485)_(71150_72080)dup | Aγ, Gγ, δ, β, pseudo β | Causative | β-thalassaemia | NG_000007.3 | 41485 |
3394 | 223 kb deletion | N/A | NC_000011.10:g.5010012_5232933del | δ, β | Causative | β-thalassaemia | NG_000007.3 | 64683 |
298 | Filipino (~45 kb deletion) | N/A | NC_000011.10:g.5112882 _5231358del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66258 |
292 | Turk (~7.6 kb deletion) | N/A | NG_000007.3:g.[52524_60162del;66278_73952del] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66278 |
2283 | South-Italy | N/A | NC_000011.10:g.5164564_5230714del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66902 |
2157 | Indian (4056 bp deletion) | N/A | NG_000007.3:g.67357_71413del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 67357 |
3997 | 7.2 kb deletion | N/A | NC_000011.10:g.5222800_5230034del | β | Causative | β-thalassaemia | NG_000007.3 | 67582 |
296 | Dutch (12620 bp deletion) | N/A | NG_000007.3:g.68071_80682del12612 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 68071 |
2124 | Caucasian HPFH (27825 bp deletion) | N/A | NC_000011.10:g.5201455_5229279delins5223936_5223960 | β | Causative | β-thalassaemia, Hb F levels | NG_000007.3 | 68337 |
1505 | South East Asian (SEA) deletion (Vietnamese, SE Asian, HPFH-7, SEA-HPFH, 27 kb deletion) | N/A | NC_000011.10:g.5201647_5229059del | β | Causative | β-thalassaemia, Hb F levels | NG_000007.3 | 68557 |
3823 | 60 kb deletion (Prachinburi β0-thalassemia deletion) | N/A | NC_000011.10:g.5167971_5228123delinsA | β | Causative | β-thalassaemia | NG_000007.3 | 69493 |
289 | Croatian (1605 bp deletion) | N/A | NG_000007.3:g.69561_71164del1604 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69561 |
2150 | 1357 bp deletion (Taiwanese deletion) | N/A | NG_000007.3:g.69997_71353del1357 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69997 |
288 | Black, British (1393 bp deletion) | N/A | NG_000007.3:g.70060_71452del1393 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70060 |
2125 | Afghan (909 bp deletion) | N/A | NG_000007:g.70067_70976del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70067 |
284 | 468 bp deletion | N/A | NG_000007.3:g.70070_70537del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70070 |
285 | Black (532 bp deletion) | N/A | HBB:c.-504_28del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70091 |
3277 | 538 bp deletion | N/A | HBB:c.-464_74del | NG_000007.3:g.70131_70668del | β | Causative | β-thalassaemia | NG_000007.3 | 70131 |
3278 | 1517 bp deletion | N/A | HBB:c.-390_316-169delinsA | β | Causative | β-thalassaemia | NG_000007.3 | 70205 |
4066 | 10.8 kb deletion | N/A | NC_000011.10:g.5216601_5227407del | β | Causative | β-thalassaemia | NG_000007.3 | 70209 |
3081 | -223 T>C | N/A | HBB:c.-273T>C | β | Causative | β-thalassaemia | NG_000007.3 | 70322 |
3562 | -198 A>G | N/A | HBB:c.-248A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70347 |
1 | -190 (G>A) | N/A | HBB:c.-240G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70355 |
2122 | 125 bp deletion | N/A | NG_000007.3:g.70360_70485del125 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70360 |
2153 | Kabylia deletion/insertion | N/A | NG_000007.3:g.70417_72458delinsATAAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70417 |
283 | 290 bp deletion | N/A | HBB:c.-176_92+25del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70419 |
4136 | -103 C>A | N/A | HBB:c.-153C>A | β | Causative | β-thalassaemia | NG_000007.3 | 70442 |
2 | -102 (C>A) | N/A | HBB:c.-152C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70443 |
3 | -101 (C>T) | N/A | HBB:c.-151C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70444 |
4 | -101 (C>G) | N/A | HBB:c.-151C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70444 |
3752 | -99 to -85 (-15bp) | N/A | HBB:c.-149_-135delGTGGAGCCACACCCT | β | Causative | β-thalassaemia | NG_000007.3 | 70446 |
3059 | -98 T>A | N/A | HBB:c.-148T>A | β | Causative | β-thalassaemia | NG_000007.3 | 70447 |
5 | -93 C>G | N/A | HBB:c.-143C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70452 |
6 | -92 (C>T) | N/A | HBB:c.-142C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70453 |
7 | -90 (C>T) | N/A | HBB:c.-140C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70455 |
3224 | -90 (C>G) | N/A | HBB:c.-140C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70455 |
3990 | -89 to -88 (-AC) | N/A | HBB:c.-139_-138delAC | β | Causative | β-thalassaemia | NG_000007.3 | 70456 |
8 | -88 (C>T) | N/A | HBB:c.-138C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
9 | -88 (C>A) | N/A | HBB:c.-138C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
2178 | -88 C>G | N/A | HBB:c.-138C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
10 | -87 C>G | N/A | HBB:c.-137C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
11 | -87 (C>T) | N/A | HBB:c.-137C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
12 | -87 (C>A) | N/A | HBB:c.-137C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
13 | -86 C>G | N/A | HBB:c.-136C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70459 |
14 | -86 (C>A) | N/A | HBB:c.-136C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70459 |
4028 | -86 C>T | N/A | HBB:c.-136C>T | β | Causative | β-thalassaemia | NG_000007.3 | 70459 |
3077 | -83 G>A | N/A | HBB:c.-133G>A | β | Causative | β-thalassaemia | NG_000007.3 | 70462 |
3069 | -77 G>C | N/A | HBB:c.-127G>C | β | Causative | β-thalassaemia | NG_000007.3 | 70468 |
3386 | -76 C>A | N/A | HBB:c.-126C>A | β | Causative | β-thalassaemia | NG_000007.3 | 70469 |
3671 | -76 C>T | N/A | HBB:c.-126C>T | β | Causative | β-thalassaemia | NG_000007.3 | 70469 |
15 | -73 (A>T) | N/A | HBB:c.-123A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70472 |
3672 | -73 A>C | N/A | HBB:c.-123A>C | β | Causative | β-thalassaemia | NG_000007.3 | 70472 |
3673 | -73 A>G | N/A | HBB:c.-123A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70472 |
2997 | -72 T>A | N/A | HBB:c.-122T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70473 |
2171 | -71 C>T | N/A | HBB:c.-121C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70474 |
3674 | -63 A>G | N/A | HBB:c.-113A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70482 |
4135 | -57 A>C | N/A | HBB:c.-107A>C | β | Causative | β-thalassaemia | NG_000007.3 | 70488 |
16 | -56 G>C | N/A | HBB:c.-106G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70489 |
17 | -50 G>A | N/A | HBB:c.-100G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70495 |
3060 | -42 C>G | N/A | HBB:c.-92C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70503 |
3925 | -42 (-C) | N/A | HBB:c.-92delC | β | Causative | β-thalassaemia | NG_000007.3 | 70503 |
2172 | -41 A>T | N/A | HBB:c.-91A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70504 |
18 | -32 (C>A) | N/A | HBB:c.-82C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70513 |
19 | -32 (C>T) | N/A | HBB:c.-82C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70513 |
20 | -31 (A>G) | N/A | HBB:c.-81A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70514 |
21 | -31 (A>C) | N/A | HBB:c.-81A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70514 |
22 | -30 (T>A) | N/A | HBB:c.-80T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
23 | -30 (T>C) | N/A | HBB:c.-80T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
2179 | -30 T>G | N/A | HBB:c.-80T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
3062 | -30 (-T) | N/A | HBB:c.-80delT | β | Causative | β-thalassaemia | NG_000007.3 | 70515 |
24 | -29 to -26 (-AA) | N/A | HBB:c.-79_78delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
25 | -29 (A>G) | N/A | HBB:c.-79A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
26 | -29 (A>C) | N/A | HBB:c.-79A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
28 | -28 (A>C) | N/A | HBB:c.-78A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70517 |
29 | -28 (A>G) | N/A | HBB:c.-78A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis, Hb F levels | NG_000007.3 | 70517 |
30 | -27 (A>T) | N/A | HBB:c.-77A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
31 | -27 (-AA) | N/A | HBB:c.-77_-76delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
2175 | -26 A>C | N/A | HBB:c.-76A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70519 |
32 | -25 (G>C) | N/A | HBB:c.-75G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70520 |
2565 | -25 G>T | N/A | HBB:c.-75G>T | β | Causative | β-thalassaemia | NG_000007.3 | 70520 |
282 | 105 bp deletion | N/A | HBB:c.-74_31del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70521 |
3926 | -17 (A>G) | N/A | HBB:c.-67A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70528 |
34 | CAP +1 (A>C) | N/A | HBB:c.-50A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70545 |
3464 | CAP +3 A>T | N/A | HBB:c.-48A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70547 |
35 | CAP +8 (C>T) | N/A | HBB:c.-43C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70552 |
36 | CAP +10 (-T) (5'UTR +10 (-T)) | N/A | HBB:c.-41delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70554 |
3627 | CAP +20 (-C) | N/A | HBB:c.-31delC | β | Causative | β-thalassaemia | NG_000007.3 | 70564 |
38 | CAP +22 (G>A) | N/A | HBB:c.-29G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70566 |
3345 | CAP +22 (G>T) | N/A | HBB:c.-29G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70566 |
3676 | CAP +27 (C>G) | N/A | HBB:c.-24C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70571 |
4134 | CAP +28 A>G | N/A | HBB:c.-23A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70572 |
33 | -22 to +23 (+45 bp duplication) | N/A | NG_000007.3:g.70573_70617dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70573 |
2536 | CAP +30 T>A | N/A | HBB:c.-21T>A | β | Causative | β-thalassaemia | NG_000007.3 | 70574 |
4089 | CAP +32 (G>C) | N/A | HBB:c.-19G>C | β | Causative | β-thalassaemia | NG_000007.3 | 70576 |
39 | CAP +33 (C>G) | N/A | HBB:c.-18C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70577 |
2176 | CAP +39 C>T | N/A | HBB:c.-12C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70583 |
40 | CAP +41 to +44 (-AACA) (CAP +40 to +43 (-AAAC)) | N/A | HBB:c.-10_-7delAACA | β | Causative | β-thalassaemia | NG_000007.3 | 70585 |
41 | CAP +45 (G>C) | Hb Odisha | HBB:c.-6G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70589 |
42 | Init CD ATG>GTG | N/A | HBB:c.1A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
43 | Init CD ATG>CTG | N/A | HBB:c.1A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
44 | Init CD ATG>ACG | N/A | HBB:c.2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
45 | Init CD ATG>AGG | N/A | HBB:c.2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
46 | Init CD ATG>AAG | N/A | HBB:c.2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
47 | Init CD ATG>ATC | N/A | HBB:c.3G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
48 | Init CD ATG>ATA | N/A | HBB:c.3G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
49 | Init CD ATG>ATT | N/A | HBB:c.3G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
50 | CD 1 (-G) | N/A | HBB:c.4delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70598 |
51 | CD 2-4 (-9 bp, +31 bp) | N/A | HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
3437 | CD 2 CAT>-AT | Hb Bundelkhand | HBB:c.7delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
3014 | CD 2 CAT>C-T | N/A | HBB:c.8delA | β | Causative | β-thalassaemia | NG_000007.3 | 70602 |
53 | CD 2/3 (+T); CD 5 (-C) | Hb Antalya | HBB:c.[9dupT; 17delC] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603, 70611 |
3561 | CD 2 CAT/CA- | N/A | HBB:c.9delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603 |
52 | CD 3 (+T) | N/A | HBB:c.11dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70605 |
3817 | CD 4 (-T) | N/A | HBB:c.14delC | β | Causative | β-thalassaemia | NG_000007.3 | 70608 |
55 | CD 4/5/6: CD 4 (ACT>ACA), CD 5 (CCT>TCT), CD 6 (GAG>TAG) | N/A | HBB:c.[15T>A;16C>T;19G>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70609, 70610, 70613 |
54 | CD 5 -CT | N/A | HBB:c.17_18delCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70611 |
2180 | CD 5/6 -TG | N/A | HBB:c.18_19delTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70612 |
56 | CD 6 (GAG>TAG) | N/A | HBB:c.19G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
58 | CD 6 (-G) | N/A | HBB:c.19delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
2184 | CD 6-14 (-26 bp) (26 bp deletion) | N/A | HBB:c.20_45del26bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
57 | CD 6 -A | N/A | HBB:c.20delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
59 | CD 6-10 (-13 bp) | N/A | HBB:c.21_33delGGAGAAGTCTGCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70615 |
60 | CD 7 GAG>TAG | N/A | HBB:c.22G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70616 |
3288 | CD7 GAG>G-G | N/A | HBB:c.23delA | β | Causative | β-thalassaemia | NG_000007.3 | 70617 |
2958 | CD 7/8 (+G) | N/A | HBB:c.24dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70618 |
61 | CD 8 (-AA) | N/A | HBB:c.25_26delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70619 |
2185 | CD 8/9 +AGAA | N/A | HBB:c.27_28insAGAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70620 |
62 | CD 8/9 (+G) | N/A | HBB:c.27dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
3513 | CD 8 AAG>AA- | N/A | HBB:c.27delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
63 | CD 9 (+TA) | N/A | HBB:c.28_29insTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70622 |
64 | CD 9/10 (+T) | Hb Gaziantep | HBB:c.30dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70624 |
4108 | CD 10 GCC>GTC [Ala>Val] | N/A | HBB:c.31_32insT | β | Causative | β-thalassaemia | NG_000007.3 | 70625 |
65 | CD 10 GCC>GCA [Ala>Ala] | N/A | HBB:c.33C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
66 | CD 10 (-C) | N/A | HBB:c.33delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
67 | CD 11 (-T) | N/A | HBB:c.36delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70630 |
3721 | CD 14 CTG>-TG | N/A | HBB:c.43delC | β | Causative | β-thalassaemia | NG_000007.3 | 70637 |
68 | CD 14 (+T) | N/A | HBB:c.44dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
2553 | CD 14 CTG>C-G | N/A | HBB:c.44delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
69 | CD 14/15 (+G) | N/A | HBB:c.45dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70639 |
70 | CD 15 (-T) | N/A | HBB:c.46delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70640 |
72 | CD 15 TGG>TAG | N/A | HBB:c.47G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70641 |
73 | CD 15 TGG>TGA | N/A | HBB:c.48G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70642 |
71 | CD 15/16 (+G) | N/A | HBB:c.50dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
74 | CD 15/16 (-G) | N/A | HBB:c.50delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
75 | CD 16 GGC>GG- | N/A | HBB:c.51delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
76 | CD 16 GGC>GGT [Gly>Gly] | N/A | HBB:c.51C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
77 | CD 17 AAG>TAG [Lys>STOP] | N/A | HBB:c.52A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70646 |
78 | CD 17 (+A) | N/A | HBB:c.53dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70647 |
2298 | CD 17 AAG>ATG (Lys>Met) | Hb Ede | HBB:c.53A>T | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70647 |
79 | CD 19 AAC>AGC [Asn>Ser] | Hb Malay | HBB:c.59A>G | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70653 |
3609 | CD 20/21 (-TGGA) | N/A | HBB:c.62_65delTGGA | β | Causative | β-thalassaemia | NG_000007.3 | 70656 |
80 | CD 20-22 (GTGGATGAA>GTGAA) | N/A | HBB:c.64_67del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
81 | CD 20/21 (+G) | N/A | HBB:c.64dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
83 | CD 22 (GAA>TAA) | N/A | HBB:c.67G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70661 |
84 | CD 22-24 ( -7 bp): (-AAGTTGG) | N/A | HBB:c.68_74delAAGTTGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70662 |
4106 | CD 23 GTT>TTT; CD 26 GAG>AAG | Hb E-Palmerston North | HBB:c.[70G>T;79G>A] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70664, 70673 |
85 | CD 24 (-G, +CAC) | N/A | HBB:c.74delinsCAC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
2174 | CD 24 -G | N/A | HBB:c.74delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
86 | CD 24 GGT>GGA [Gly>Gly] | N/A | HBB:c.75T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70669 |
281 | IVS I [3 end] -44 bp (44 bp deletion) | N/A | HBB:c.76_92+27del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70670 |
87 | CD 25/26 (+T) | N/A | HBB:c.78dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70672 |
88 | CD 26 GAG>AAG [Glu>Lys] | HbE | HBB:c.79G>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
89 | CD 26 (GAG>TAG) | N/A | HBB:c.79G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
90 | CD 26 (+T) | N/A | HBB:c.79_80insT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
3409 | CD 26 GAG>AAG, IVS I-7 A>G | Hb E-Udon Thani | HBB:c.[79G>A;92+7A>G] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70673, 70693 |
3597 | CD 26 (GAG>AAG); CD 104 (AGG>GGG) | Hb E-Gurdaspur | HBB:c.[79G>A;313A>G] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70673, 71037 |
4023 | CD 26 GAG>AAG, IVS I-7 A>T | N/A | HBB:c.[79G>A;92+7A>T] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70673, 70693 |
91 | CD 27 GCC>TCC [Ala>Ser] | Hb Knossos | HBB:c.82G>T | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70676 |
92 | CD 27/28 (+C) | N/A | HBB:c.85dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
93 | CD 28 (-C) | N/A | HBB:c.85delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
94 | CD 28 CTG>CGG [Leu >Arg] | Hb Chesterfield | HBB:c.86T>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70680 |
95 | CD 28/29 (-G) | N/A | HBB:c.89delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70683 |
96 | CD 29 (C>T) or IVS I (-3) GGC>GGT (Gly>Gly) | N/A | HBB:c.90C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70684 |
97 | CD 30 (A>G) or IVS I (-2) AGG>GGG (Arg>Gly) | N/A | HBB:c.91A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
98 | CD 30 (A>C) or IVS I (-2) AGG>CGG [Arg>Arg] | N/A | HBB:c.91A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
3484 | CD 30 (-A) or IVS I (-2) AGG>-GG | N/A | HBB:c.91delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
3710 | CD 30 AGG>TGG [Arg>Trp] | Hb New Berlin | HBB:c.91A>T | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70685 |
99 | CD 30 (G>A) or IVS I (-1) AGG>AAG (Arg>Lys) | N/A | HBB:c.92G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70686 |
100 | CD 30 (G>C) or IVS I (-1) AGG>ACG (Arg>Thr) (Hb Kairouan) | Hb Monroe | HBB:c.92G>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70686 |
101 | IVS I-1 G>A | N/A | HBB:c.92+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
102 | IVS I-1 (G>T) | N/A | HBB:c.92+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
103 | IVS I-1 (G>C) | N/A | HBB:c.92+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
104 | IVS I-2 (T>G) | N/A | HBB:c.92+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
105 | IVS I-2 (T>C) | N/A | HBB:c.92+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
106 | IVS I-2 (T>A) | N/A | HBB:c.92+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
107 | IVS I-5 (G>C) | N/A | HBB:c.92+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
108 | IVS I-5 (G>T) | N/A | HBB:c.92+5G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
109 | IVS I-5 (G>A) | N/A | HBB:c.92+5G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
111 | IVS I-6 (T>C) | N/A | HBB:c.92+6T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70692 |
3565 | IVS I-6 (T>G) | N/A | HBB:c.92+6T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70692 |
112 | IVS I-7 A>T | N/A | HBB:c.92+7A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70693 |
3276 | IVS I-7 A>G | N/A | HBB:c.92+7A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70693 |
3690 | IVS I-65 (G>A) | N/A | HBB:c.92+65G>A | β | Causative | β-thalassaemia | NG_000007.3 | 70751 |
3066 | IVS I-108 T>C | N/A | HBB:c.93-23T>C | β | Causative | β-thalassaemia | NG_000007.3 | 70794 |
280 | IVS I [3' end] (-25 bp) (25 bp deletion) | N/A | NC_000011.10(NM_000518.4):c.93-22_95del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
2173 | IVS I-109 (-T) | N/A | HBB:c.93-22delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
113 | IVS I-110 G>A | N/A | HBB:c.93-21G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70796 |
121 | IVS I [3' end] (-17 bp) (17 bp deletion) | N/A | HBB:c.93-17_93-1delTATTTTCCCACCCTTAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70800 |
3008 | IVS I-115 (A>T) | N/A | HBB:c.93-16A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70801 |
114 | IVS I-116 (T>G) | N/A | HBB:c.93-15T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70802 |
124 | IVS I [3' end] (+22bp) | N/A | NG_000007.3:g.70807_70828dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70807 |
115 | IVS I-128 (T>G) | N/A | HBB:c.93-3T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70814 |
116 | IVS I-129 (A>C) | N/A | HBB:c.93-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
117 | IVS I-129 (A>G) | N/A | HBB:c.93-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
4067 | IVS I-129 (A>T) | N/A | HBB:c.93-2A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70815 |
118 | IVS I-130 G>C | N/A | HBB:c.93-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
119 | IVS I-130 (G>A) | N/A | HBB:c.93-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
120 | IVS I-130 (+1) or CD 30, (G>C); AGG>AGC (Arg>Ser) | Hb Tacoma II | HBB:c.93G>C | β | Causative | β-thalassaemia | NG_000007.3 | 70817 |
125 | CD 30/31 +CGG [+Arg] | N/A | HBB:c.93_94insCGG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70817 |
126 | CD 31 (-C) | N/A | HBB:c.94delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70818 |
127 | CD 32 CTG>CAG: CD 98 GTG>ATG | Hb Medicine Lake | HBB:c.[98T>A; 295G>A] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70822 |
131 | CD 33-35 (-TGGTCT) | Hb Dresden | HBB:c.101_106delTGGTCT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70825 |
129 | CD 33/34 (GTGGTC>GTC) | Hb Korea | HBB:c.102_104del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
130 | CD 33-34 (-G) | N/A | HBB:c.102_103delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
3700 | CD 34 GTC>GCC [Val>Ala] | Hb San Francisco-KP | HBB:c.104T>C | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70828 |
132 | CD 35 TAC>TGC [Tyr>Cys] | N/A | HBB:c.107A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70831 |
133 | CD 35 TAC>TAA | N/A | HBB:c.108C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70832 |
3023 | CD 35 TAC>TAG | N/A | HBB:c.108C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70832 |
3692 | CD 35 (TAC>TA-) | N/A | HBB:c.108delC | β | Causative | β-thalassaemia | NG_000007.3 | 70832 |
128 | CD 36 CCT>C-T (CD 36 (-C)) | N/A | HBB:c.110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70834 |
135 | CD 36-39 (-8 bp) | N/A | HBB:c.111_118delTTGGACCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70835 |
134 | CD 36/37 (-T) | N/A | HBB:c.112delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70836 |
138 | CD 37 (TGG>TAG) | N/A | HBB:c.113G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70837 |
136 | CD 37 (-G) | N/A | HBB:c.114delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
137 | CD 37 (TGG>TGA) | N/A | HBB:c.114G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
139 | CD 37-39 (-7 bp): (-GACCCAG) | N/A | HBB:c.114_120del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
141 | CD 38/39 (-CC) | N/A | HBB:c.117_118delCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70841 |
140 | CD 38/39 (-C) | N/A | HBB:c.118delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
142 | CD 39 CAG>TAG [Gln>STOP] | N/A | HBB:c.118C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
2393 | CD 39 -A | N/A | HBB:c.119delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70843 |
143 | CD 40 (-G) | N/A | HBB:c.123delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
144 | CD 40 (+86 bp) (HGSA) | N/A | HBB:c.123_208dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
145 | CD 40/41 (+T) | N/A | HBB:c.125dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70849 |
146 | CD 41 (-C) | N/A | HBB:c.126delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
147 | CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT)) | N/A | HBB:c.126_129delCTTT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
148 | CD 42/43 (+T) | N/A | HBB:c.129dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70853 |
2954 | CD 42 TTT>TT- | Hb Yala | HBB:c.129delT | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70853 |
149 | CD 42/43 (+G) | N/A | HBB:c.130dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
150 | CD 43 (GAG>TAG) | N/A | HBB:c.130G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
3594 | CD 43 (GAG>TAG);CD 71/72 (+A) | N/A | HBB:c.[130G>T;217dupA] | β | Causative | β-thalassaemia | NG_000007.3 | 70854, 70941 |
151 | CD 44 -C | N/A | HBB:c.135delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70859 |
152 | CD 45 (-T) | N/A | HBB:c.138delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
153 | CD 45 (+T) | N/A | HBB:c.138dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
154 | CD 45/46 (+A) | N/A | HBB:c.138_139insA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
2960 | CD 46/47 (+G) | N/A | HBB:c.142_142dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70866 |
155 | CD 47 (+A) | N/A | HBB:c.143dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
156 | CD 47/48 (+ATCT) | N/A | HBB:c.143_146dupATCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
2187 | CD 48 -T | N/A | HBB:c.146delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70870 |
2407 | CD 49-55 (-19 bp +4 bp) | Hb Martinez | HBB:c.149_167delinsAGCT | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70873 |
157 | CD 49 (-C) | N/A | HBB:c.150delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70874 |
3571 | CD 50 ACT>GCT [Thr>Ala] | N/A | HBB:c.151A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70875 |
3940 | CD 50 ACT>TCT [Thr>Ser]; IVS II-654 C>T | Hb Zurich-Langstrasse | HBB:c.[151A>T;316-197C>T] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70875, 71693 |
158 | CD 50 (-T) | N/A | HBB:c.153delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70877 |
159 | CD 51 (-C) | N/A | HBB:c.155delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70879 |
2959 | CD 52 GAT>G-T | N/A | HBB:c.158delA | β | Causative | β-thalassaemia | NG_000007.3 | 70882 |
160 | CD 53 (-T) | N/A | HBB:c.162delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70886 |
161 | CD 53/54 (+G) | N/A | HBB:c.163dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70887 |
4094 | CD 54 GTT>-TT | N/A | HBB:c.163del | β | Causative | β-thalassaemia | NG_000007.3 | 70887 |
162 | CD 54 -T | N/A | HBB:c.165delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
164 | CD 54-58 (-13bp) | N/A | HBB:c.165_177delTATGGGCAACCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
163 | CD 54/55 (+A) | N/A | HBB:c.166dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
165 | CD 55 (-A) | N/A | HBB:c.166delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
2990 | CD 55-59 (-13 bp) | N/A | HBB:c.167_179del | β | Causative | β-thalassaemia | NG_000007.3 | 70891 |
166 | CD 56-60 (+14 bp) | N/A | HBB:c.170_183dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70894 |
167 | CD 58 (+C) | N/A | HBB:c.176dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70900 |
3311 | CD 58 CCT>C-T | N/A | HBB:c.176delC | β | Causative | β-thalassaemia | NG_000007.3 | 70900 |
169 | CD 59 (AAG>TAG) | N/A | HBB:c.178A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70902 |
3061 | CD 59 (+T) | N/A | HBB:c.178_179insT | β | Causative | β-thalassaemia | NG_000007.3 | 70902 |
168 | CD 59 -A | N/A | HBB:c.179delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70903 |
4086 | CD 59 AAG>AA-, CD 59 (-G) | N/A | HBB:c.180del | β | Causative | β-thalassaemia | NG_000007.3 | 70904 |
3855 | CD 60 GTG>-TG [Val>STOP] | N/A | HBB:c.181delG | β | Causative | β-thalassaemia | NG_000007.3 | 70905 |
170 | CD 60 GTG>GAG [Val>Glu] | Hb Cagliari | HBB:c.182T>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70906 |
172 | CD 61 (AAG>TAG) | N/A | HBB:c.184A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70908 |
2190 | CD 62-83 (+65 bp) | N/A | HBB:c.187_251dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70911 |
3589 | CD 62-65 (-12bp) | N/A | HBB:c.187_198delGCTCATGGCAAG | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 70911 |
171 | CD 62-64 (-7bp) | N/A | HBB:c.189_195delTCATGGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70913 |
173 | CD 64 (-G) | N/A | HBB:c.194delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70918 |
2976 | CD 64 GGC>GTC [Gly>Val] | Hb Calgary | HBB:c.194G>T | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70918 |
3944 | CD 64 (+G) | N/A | HBB:c.194dup | β | Causative | β-thalassaemia | NG_000007.3 | 70918 |
174 | CD 66 AAA>TAA [Lys>STOP] | N/A | HBB:c.199A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70923 |
3854 | CD 66/67 (-AAAG) | N/A | HBB:c.199_202delAAAG | β | Causative | β-thalassaemia | NG_000007.3 | 70923 |
2188 | CD 66 -A | N/A | HBB:c.201delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70925 |
175 | CD 67 (-TG) | N/A | HBB:c.203_204delGT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70927 |
3019 | CD 68-70 (-7bp): (-TCGGTGC) | N/A | HBB:c.206_212delTCGGTGC | β | Causative | β-thalassaemia | NG_000007.3 | 70930 |
2522 | CD 69 GGT>G-T | N/A | HBB:c.209delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70933 |
2189 | CD 69 -T | N/A | HBB:c.210delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70934 |
176 | CD 71 (+T) | N/A | HBB:c.216dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70940 |
2462 | CD 71 -T | N/A | HBB:c.216delT | β | Causative | β-thalassaemia | NG_000007.3 | 70940 |
177 | CD 71/72 (+A) | N/A | HBB:c.217dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
178 | CD 72-73 (-AGTGA, +T) | N/A | HBB: c.217_221delAGTGAinsT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
2181 | CD 72/73 (+T) | N/A | HBB:c.219dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70943 |
3374 | CD 72 AGT>AGA [Ser>Arg]; CD 73 GAT>TAT [Asp>Tyr] | Hb South China | HBB:c.[219T>A;220G>T] | β | Causative | β-thalassaemia | NG_000007.3 | 70943, 70944 |
179 | CD 75 (-C) | N/A | HBB:c.226delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70950 |
180 | CD 76 GCT>--T (-GC) | N/A | HBB:c.229_230delGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70953 |
181 | CD 76 (-C) | N/A | HBB:c.230delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70954 |
182 | CD 78 CTG>-TG | N/A | HBB:c.235delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70959 |
3299 | CD 77/78 (+C) | N/A | HBB:c.235dupC | β | Causative | β-thalassaemia | NG_000007.3 | 70959 |
3225 | CD 78/85 (-20bp) | N/A | HBB:c.237_256delGGACAACCTCAAGGGCACCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70961 |
183 | CD 80/81 (-C) | N/A | HBB:c.244delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
184 | CD 81-87 (-22 bp) | N/A | HBB:c.244_265del22 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
185 | CD 82/83 (-G) | N/A | HBB:c.251delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70975 |
186 | CD 84-86 (-8 bp): (-CACCTTTG) | N/A | HBB:c.253_260del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70977 |
187 | CD 84/85 (+C) | N/A | HBB:c.255dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70979 |
188 | CD 84-86 (+T) | N/A | HBB:c.258dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70982 |
4125 | CD 85 (-T) | N/A | HBB:c.258del | β | Causative | β-thalassaemia, Anaemia | NG_000007.3 | 70982 |
3722 | CD 86 GCC>GC- | N/A | HBB:c.261delC | β | Causative | β-thalassaemia | NG_000007.3 | 70985 |
4044 | CD 87-91 (-14 bp) | N/A | HBB:c.263_276del | β | Causative | β-thalassaemia | NG_000007.3 | 70987 |
3253 | CD 88 CTG>--G (HBB:c.265_266delCT) | N/A | HBB:c.265_266del | β | Causative | β-thalassaemia | NG_000007.3 | 70989 |
189 | CD 88 (+T) | N/A | HBB:c.266dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
190 | CD 88 (-TG) | N/A | HBB:c.266_267del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
3287 | CD 89-93 (-14bp): (-AGTGAGCTGCACTG) | N/A | HBB:c.268_281delAGTGAGCTGCACTG | β | Causative | β-thalassaemia | NG_000007.3 | 70992 |
191 | CD 89/90 (AGTGAG>AGAG) | N/A | HBB:c.270_271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70994 |
192 | CD 90 GAG>TAG | N/A | HBB:c.271G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70995 |
3044 | CD 90 GAG>-AG | N/A | HBB:c.271delG | β | Causative | β-thalassaemia | NG_000007.3 | 70995 |
3057 | CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG) | N/A | HBB:c.272_295dup | β | Causative | β-thalassaemia | NG_000007.3 | 70996 |
3133 | IVS II-1 G>A and CD 91 CTG>TTG [Leu>Leu] | N/A | HBB:c.[315+1G>A; 274C>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70998, 71040 |
193 | CD 91 CTG>C-G | Hb Morgantown | HBB:c.275del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
194 | CD 91 (+T) | N/A | HBB:c.275dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
195 | CD 93/94 (+TG) | Hb Agnana | HBB:c.282_283dupTG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71006 |
196 | CD 95 (+A) | N/A | HBB:c.287dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71011 |
3888 | CD 97/98 (+GCAC) | N/A | HBB:c.291_294dup | β | Causative | β-thalassaemia | NG_000007.3 | 71015 |
198 | CD 100 (-CC,+TCTGAGAACTT) >158aa | N/A | HBB:c.301_302delCCinsTCTGAGAACTT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71025 |
2279 | CD 102 AAC>ATCAC | N/A | HBB:c.308insTC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71032 |
3636 | CD 104 (-A) | N/A | HBB:c.313delA | β | Causative | β-thalassaemia | NG_000007.3 | 71037 |
199 | IVS II-1 (-G) | N/A | HBB:c.315+1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
200 | IVS II-1 G>A | N/A | HBB:c.315+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
201 | IVS II-1 G>C | N/A | HBB:c.315+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
202 | IVS II-1 G>T | N/A | HBB:c.315+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
203 | IVS II-2 T>C | N/A | HBB:c.315+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
204 | IVS II-2 (T>A) | N/A | HBB:c.315+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
205 | IVS II-2 (-T) | N/A | HBB:c.315+2del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
206 | IVS II-2/3 (-2 bp, +11 bp) (IVS II-2,3 (+11/-2)) | N/A | HBB:c.315+2_315+3delinsACGTTCTCTGA | β | Causative | β-thalassaemia | NG_000007.3 | 71041 |
2182 | IVS II-2 -TGAGTCTATGGG | N/A | HBB:c.315+2_315+13delTGAGTCTATGGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
3226 | IVS II-2 T>G | N/A | HBB:c.315+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
207 | IVS II 4/5 -AG | N/A | NG_000007.3:g.71043_71044delAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71043 |
208 | IVS II-5 (G>C) | N/A | HBB:c.315+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71044 |
3677 | IVS II-15 (C>T) | N/A | HBB:c.315+15C>T | β | Causative | β-thalassaemia | NG_000007.3 | 71054 |
3678 | IVS II-45 (A>G) | N/A | HBB:c.315+45A>G | β | Causative | β-thalassaemia | NG_000007.3 | 71084 |
3681 | IVS II-63 (T>C) | N/A | HBB:c.315+63T>C | β | Causative | β-thalassaemia | NG_000007.3 | 71102 |
3680 | IVS II-70 (G>A) | N/A | HBB:c.315+70G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71109 |
3679 | IVS II-129 (G>A) | N/A | HBB:c.315+129G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71168 |
3977 | IVS II-132 G>C | N/A | HBB:c.315+132G>C | β | Causative | β-thalassaemia | NG_000007.3 | 71171 |
4040 | IVS II-143 G>A | N/A | HBB:c.315+143G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71182 |
3682 | IVS II-180 (T>C) | N/A | HBB:c.315+180T>C | β | Causative | β-thalassaemia | NG_000007.3 | 71219 |
3683 | IVS II-308 (-A) | N/A | HBB:c.315+308delA | β | Causative | β-thalassaemia | NG_000007.3 | 71347 |
4046 | IVS II-337 A>G | N/A | HBB:c.315+337A>G | β | Causative | β-thalassaemia | NG_000007.3 | 71376 |
3996 | 4.9 Kb deletion (NG_000007.3:g.71429_76331del) | N/A | NC_000011.10:g.5226187_5231089del | β | Causative | β-thalassaemia, Ineffective erythropoiesis | NG_000007.3 | 71429 |
3797 | IVS II-509 (-A) | N/A | HBB:c.316-342delA | β | Causative | β-thalassaemia | NG_000007.3 | 71548 |
209 | IVS II-535 - CD 108 (+23, -310, +28) | Hb Jambol | HBB:c.[316-300_327delinsCAGGTGCCATCTGTCACCCTTTTCTTTG;316-316_316-315insAATATATTTTTAATATACTTTTT] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71590 |
286 | 619 bp deletion (Asian Indian) | N/A | NG_000007.3:g.71609_72227del619 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71609 |
210 | IVS II-613 (C>T) | N/A | HBB:c.316-238C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71652 |
3391 | IVS II-648/649 (-T) | N/A | HBB:c.316-202del | β | Causative | β-thalassaemia | NG_000007.3 | 71688 |
211 | IVS II-654 C>T | N/A | HBB:c.316-197C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71693 |
3866 | IVS II-659_664 (-GCAATA) | N/A | HBB:c.316-192_187del | β | Causative | β-thalassaemia | NG_000007.3 | 71698 |
3686 | IVS II-672 (A>C) | N/A | HBB:c.316-179A>C | β | Causative | β-thalassaemia | NG_000007.3 | 71711 |
212 | IVS II-705 (T>G) | N/A | HBB:c.316-146T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71744 |
3796 | IVS II-716 (+T) | N/A | HBB:c.316-135dupT | β | Causative | β-thalassaemia | NG_000007.3 | 71755 |
213 | IVS II-726 A>G | N/A | HBB:c.316-125A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71765 |
214 | IVS II-745 C>G | N/A | HBB:c.316-106C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71784 |
3928 | IVS II-752 T>G | N/A | HBB:c.316-99T>G | β | Causative | β-thalassaemia | NG_000007.3 | 71791 |
2200 | IVS II-765 L1 insertion (+CTGCTTTTATTTT) | N/A | HBB:c.316-98_316-86dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71792 |
215 | IVS II-761 A>G | N/A | HBB:c.316-90A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71800 |
2183 | IVS II-781 C>G | N/A | HBB:c.316-70C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71820 |
4088 | IVS II-786 T>A | N/A | HBB:c.316-65T>A | β | Causative | β-thalassaemia | NG_000007.3 | 71825 |
3687 | IVS II-806 (G>C) | N/A | HBB:c.316-45G>C | β | Causative | β-thalassaemia | NG_000007.3 | 71845 |
3616 | IVS II-809 (-G) | N/A | HBB:c.316-42delG | β | Causative | β-thalassaemia | NG_000007.3 | 71848 |
216 | IVS II-815 (C>T) | N/A | HBB:c.316-36C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71854 |
3558 | IVS II-821 (A>C) | N/A | HBB:c.316-30A>C | β | Causative | β-thalassaemia | NG_000007.3 | 71860 |
217 | IVS II-837 (T>G) | N/A | HBB:c.316-14T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71876 |
218 | IVS II-843 (T>G) | N/A | HBB:c.316-8T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71882 |
219 | IVS II-844 (C>A) | N/A | HBB:c.316-7C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71883 |
220 | IVS II-844 (C>G) | N/A | HBB:c.316-7C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71883 |
221 | IVS II-848 (C>A) | N/A | HBB:c.316-3C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71887 |
222 | IVS II-848 (C>G) | N/A | HBB:c.316-3C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71887 |
3045 | IVS II-848 C>T | N/A | HBB: c.316-3C>T | β | Causative | β-thalassaemia | NG_000007.3 | 71887 |
223 | IVS II-849 (A>G) | N/A | HBB:c.316-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
224 | IVS II-849 (A>C) | N/A | HBB:c.316-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
225 | IVS II-850 G>C | N/A | HBB:c.316-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
226 | IVS II-850 (G>A) | N/A | HBB:c.316-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
227 | IVS II-850 (G>T) | N/A | HBB:c.316-1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
228 | IVS II-850 (-G) | N/A | HBB:c.316-1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
229 | CD 106 (CTG >GTG) Leu to Val (Hb Federico II) | Hb L'Aquila | HBB:c.319C>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71893 |
230 | CD 106 CTG>CGG [Leu>Arg] | Hb Terre Haute | HBB:c.320T>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71894 |
231 | CD 107 (+G) | N/A | HBB:c.323dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
2191 | CD 107-111 (-12 bp): (-GCAACGTGCTGG) | N/A | HBB:c.323_334del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
232 | CD 108-112 (-12 bp) Asn-Val-Leu-Val-Cys to Ser | N/A | HBB:c.326_337delACGTGCTGGTCT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71900 |
233 | CD 109 (-G) >156aa | Hb Manhattan | HBB:c.328delG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71902 |
4064 | CD109/110 (-GCT +CAGCACGATG) | N/A | HBB:c.330_332delinsCAGCACGATG | β | Causative | β-thalassaemia | NG_000007.3 | 71904 |
234 | CD 110 CTG>CCG [Leu>Pro] | Hb Showa-Yakushiji | HBB:c.332T>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71906 |
3024 | CD 111-115 (-12bp): (-TCTGTGTGCTGG) | N/A | HBB:c.335_346del | β | Causative | β-thalassaemia | NG_000007.3 | 71909 |
4075 | CD 111/112 (+C) | N/A | HBB:c.336dup | β | Causative | β-thalassaemia | NG_000007.3 | 71910 |
235 | CD 112 (TGT>TGA) | N/A | HBB:c.339T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
2192 | CD 114/115 (+TGTGCTG) | N/A | HBB:c.339_345dupTGTGCTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
236 | CD 113 (-G) >156aa | N/A | HBB:c.340delG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71914 |
238 | CD 114 (-CT, +G) >156aa | Hb Geneva | HBB:c.343_344delinsG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71917 |
237 | CD 114 CTG>CCG [Leu>Pro] (Hb Brescia) | Hb Durham-N.C. | HBB:c.344T>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71918 |
3750 | CD 115 GCC>ACC [Ala>Thr] | N/A | HBB:c.346G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71920 |
239 | CD 115 (GCC>GAC) Ala to Asp | Hb Hradec Kralove (HK) | HBB:c.347C>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71921 |
3308 | CD 115-116 (-CC, +G) >156aa | Hb Grand Junction | HBB:c.348_349delinsG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 71922 |
3228 | CD 116 CAT>-AT | N/A | HBB:c.349del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71923 |
240 | CD 116 (+TGAT) | N/A | HBB:c.349_350insTGAT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71924 |
2193 | CD 117 -C | N/A | HBB:c.354delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71928 |
3846 | CD 118 (-TT) | N/A | HBB:c.356_357delTT | β | Causative | β-thalassaemia | NG_000007.3 | 71930 |
241 | CD 118 (-T) > 156aa | Hb Sainte Seve | HBB:c.357delT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71931 |
4113 | CD 119-121 (+8 bp) | Hb Nanjing | HBB:c.358_365dup | β | Causative | β-thalassaemia | NG_000007.3 | 71932 |
242 | CD 120 -A [156 aa] (CD 120 AAA>AA-) | Hb Filottrano | HBB:c.363delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71937 |
243 | CD 120/121 (+A) | N/A | HBB:c.363dupA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71937 |
244 | CD 121 GAA>TAA (120aa) | N/A | HBB:c.364G>T | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71938 |
245 | CD 123 (-A) >156aa | Hb Makabe | HBB:c.370delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71944 |
246 | CD 123-125 (-ACCCCACC) >135aa | Hb Khon Kaen | HBB:c.370_378delACCCCACCA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71944 |
3555 | CD 124 (+C) | N/A | HBB:c.374dup | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 71948 |
247 | CD 124 (-A) >156aa | N/A | HBB:c.375delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
2194 | CD 124/125 (+A) | N/A | HBB:c.375dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
248 | CD 125 (+CCA) | N/A | HBB:c.376_378dupCCA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71950 |
3227 | CD 125-126 (+CCAGT) | N/A | HBB:c.376_380dupCCAGT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71950 |
2195 | CD 125-127 (-CAGTGC) | N/A | HBB:c.377_382delCAGTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71951 |
249 | CD 125 (-A) >156aa | N/A | HBB:c.378delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71952 |
3563 | CD 126 GTG>-TG | N/A | HBB:c.379delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71953 |
250 | CD 126 (-T) >156aa | Hb Vercelli | HBB:c.380delT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71954 |
252 | CD 126-131 (-17 bp) | Hb Westdale | HBB:c.380_396delTGCAGGCTGCCTATCAG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 71954 |
1235 | CD 126 GTG>GGG [Val>Gly] (Hb Neapolis) | Hb Dhonburi | HBB:c.380T>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71954 |
255 | CD 127 CAG>TAG [Gln>STOP] | N/A | HBB:c.382C>T | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71956 |
4087 | CD 128-134 (-21bp): (-CAGGCTGCCTATCAGAAAGTG) | N/A | HBB:c.382_402del | β | Causative | β-thalassaemia | NG_000007.3 | 71956 |
253 | CD 127 (CAG>CCG) Gln to Pro | Hb Houston | HBB:c.383A>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
254 | CD 127 CAG>CGG [Gln>Arg] | Hb Dieppe | HBB:c.383A>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
256 | CD 127/128 -AGG [Glu-Ala>Pro] | Hb Gunma | HBB:c.383_385delAGG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
257 | CD 128/129 (-4, +5, -11 bp) >153aa | N/A | HBB:c.[385_388delinsCCACA;397_407delAAAGTGGTGGC] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71959 |
1241 | CD 128 GCT>CCT | Hb Mont Saint Aignan | HBB:c.385G>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71959 |
3927 | CD 128 GCT>-CT | N/A | HBB:c.385delG | β | Causative | β-thalassaemia | NG_000007.3 | 71959 |
2196 | CD 130 TAT>TAA [Tyr>STOP] | N/A | HBB:c.393T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71967 |
3860 | CD 130 TAT>TAG [Tyr>STOP] | N/A | HBB:c.393T>G | β | Causative | β-thalassaemia | NG_000007.3 | 71967 |
258 | CD 131 (CAG>TAG) | N/A | HBB:c.394C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71968 |
2197 | CD 131 (+A) | N/A | HBB:c.395dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71969 |
259 | CD 131/132 (+GCCT) | N/A | HBB:c.396_397insGCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
260 | CD 131-132 (-GA) >138aa | N/A | HBB:c.396_397delGA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
261 | CD 131-134 (-11bp) >134aa | N/A | HBB:c.396_406del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
262 | CD 132 (AAA>TAA) | N/A | HBB:c.397A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71971 |
1257 | CD 132 AAA>CAA [Lys>Gln] | Hb K Woolwich | HBB:c.397A>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71971 |
3896 | CD 132 (AAA>AA-) | N/A | HBB:c.399del | β | Causative | β-thalassaemia | NG_000007.3 | 71973 |
263 | CD 134-137 (-12, +6 bp) Val-Ala-Gly-Val to Gly-Arg | N/A | HBB:c.404_413delinsGCAG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71978 |
1264 | CD 134 GTG>GAG | Hb North Shore | HBB:c.404T>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71978 |
264 | CD 137-139 (-TGGCTA) Val-Ala-Asn to Asp | Hb Stara Zagora | HBB:c.413_418delTGGCTA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71987 |
3361 | CD 138/139 (+T) | N/A | HBB:c.417dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71991 |
2282 | CD 139/140 +T [163 aa] | Hb Boston-Kuwait | HBB:c.420dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71994 |
265 | CD 141 (-C) >156aa | Hb Florida | HBB:c.424delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71998 |
3980 | CD 141 CTG>CCG [Leu>Pro] | Hb Yoshkar-Ola | HBB:c.425T>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia | NG_000007.3 | 71999 |
1290 | CD 142 (-CC) | Hb Uzes | HBB:c.429_430delCC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72003 |
2024 | CD 143 (-C) | Hb Montreal II | HBB:c.430delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72004 |
3400 | CD 147 TAA>CAA [Stop>Gln] | Hb Zunyi | HBB:c.442T>C | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 72016 |
3697 | CD 147 TAA>ΑAA [Stop>Lys] | Hb Mokum | HBB:c.442T>A | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 72016 |
3444 | CD 147 TAA>TCA [Stop>Ser] | Hb Kanagawa | HBB:c.443A>C | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 72017 |
4104 | CD 147 TAA>ΑAC [Stop>Tyr] | N/A | HBB:c.444A>C | β | Causative | β-thalassaemia | NG_000007.3 | 72018 |
3863 | 3'UTR +1 G>A | N/A | HBB:c.*1G>A | β | Causative | β-thalassaemia | NG_000007.3 | 72019 |
267 | 3'UTR +6 C>G (Terminal CD +6 C>G, CAP +1480, β nt 1480 C>G) | N/A | HBB:c.*6C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72024 |
3688 | 3'UTR +21 A>G | N/A | HBB:c.*21A>G | β | Causative | β-thalassaemia | NG_000007.3 | 72039 |
2177 | 3'UTR +32 A>C (3'UTR +1506 (A>C), Terminal CD +32 A>C) | N/A | HBB:c.*32A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72050 |
268 | 3'UTR +47 C>G (Terminal CD +47 C>G) | N/A | HBB:c.*47C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72065 |
3180 | 3'UTR +62 A>G | N/A | HBB:c.*62A>G | β | Causative | β-thalassaemia | NG_000007.3 | 72080 |
269 | 3'UTR -13 bp [CAP +1567 to +1579] | N/A | HBB:c.*93_*105delATCTGGATTCTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72111 |
3048 | 3'UTR, +C, -TGGATTCT | N/A | HBB:c.*96_*103delTGGATTCTinsC | β | Causative | β-thalassaemia | NG_000007.3 | 72113 |
3443 | Cap +1570 (T>C) | N/A | HBB:c.*96T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72114 |
4076 | Cap +1570 (T>G) | N/A | HBB:c.*96T>G | β | Causative | β-thalassaemia | NG_000007.3 | 72114 |
270 | Poly A (A>C) AATAAA>CATAAA | N/A | HBB:c.*108A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72126 |
271 | Poly A (A>G) AATAAA>GATAAA | N/A | HBB:c.*108A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72126 |
272 | Poly A (T>C) AATAAA>AACAAA | N/A | HBB:c.*110T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
273 | Poly A (T>A) AATAAA>AAAAAA | N/A | HBB:c.*110T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
277 | Poly A (-TA); (AATAAA>AAAA) | N/A | HBB:c.*110_*111delTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
278 | Poly A (-AATAA) (polyA (-TAAAA)) | N/A | HBB:c.*110_*114del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
4025 | Poly A (-T) AATAAA>AA-AAA | N/A | HBB:c.*110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
274 | Poly A (A>G) AATAAA>AATGAA | N/A | HBB:c.*111A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72129 |
275 | Poly A (A>G) AATAAA>AATAGA | N/A | HBB:c.*112A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72130 |
2198 | Poly A (A>T) AATAAA>AATATA | N/A | HBB:c.*112A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72130 |
276 | Poly A (A>G) AATAAA>AATAAG | N/A | HBB:c.*113A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72131 |
3046 | 3'UTR +115-+116 (-AA) (Poly A (-AA)) | N/A | HBB:c.*115_*116del | β | Causative | β-thalassaemia | NG_000007.3 | 72133 |
3933 | 3'UTR +116 (+A) (β nt + 1590 (+A)) | N/A | HBB:c.*116dup | β | Causative | β-thalassaemia | NG_000007.3 | 72134 |
2564 | 3'UTR +118 (A>G) (3'UTR +1592 (A>G)) | N/A | HBB:c.*118A>G | β | Causative | β-thalassaemia | NG_000007.3 | 72136 |
3786 | 3'UTR +129 T>A | N/A | HBB:c.*129T>A | β | Causative | β-thalassaemia | NG_000007.3 | 72147 |
3605 | 3'UTR +132 C>T | N/A | HBB:c.*132C>T | β | Causative | β-thalassaemia | NG_000007.3 | 72150 |
4018 | 3'UTR +132 C>G | N/A | HBB:c.*132C>G | β | Causative | β-thalassaemia | NG_000007.3 | 72150 |
3932 | TTS +8 T>C (β nt +1616 T>C) | N/A | HBB:c.*142T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72160 |
3931 | TTS +22 G>C (β nt +1630 G>C) | N/A | HBB:c.*156G>C | β | Causative | β-thalassaemia | NG_000007.3 | 72174 |
3930 | TTS +43 (+A) (β nt +1651 (+A)) | N/A | HBB:c.*177dup | β | Causative | β-thalassaemia | NG_000007.3 | 72195 |
2496 | TTS +48 G>A (CAP +1656 G>A) | N/A | HBB:c.*182G>A | β | Causative | β-thalassaemia | NG_000007.3 | 72200 |
2463 | TTS +99 C>C | N/A | HBB:c.*233G>C | β | Causative | β-thalassaemia | NG_000007.3 | 72251 |
3929 | TTS +113 T>C (β nt + 1721 T>C) | N/A | HBB:c.*247T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72265 |
3689 | TTS +127 T>C | N/A | HBB:c.*261T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72279 |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2025-06-03 04:55:16