IthaID: 3697
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 147 TAA>ΑAA [Stop>Lys] | HGVS Name: | HBB:c.442T>A |
Hb Name: | Hb Mokum | Protein Info: | β 147, Stop>Lys; modified C-terminal sequence: (147)Lys-Ala-Arg-Phe-Leu-Ala-Val-Gln-Phe-Leu-Leu- Lys-Val-Pro-Leu-Phe-Pro-Lys-Ser-Asn-(167)Tyr-COOH |
Context nucleotide sequence:
CTAATGCCCTGGCCCACAAGTATCAC [T/A] AAGCTCGCTTTCTTGCTGTCCAATTT (Strand: -)
Also known as:
Comments: Reported as a de novo mutation in a patient with hemolytic anaemia, leading to dominant β-thalassaemia state. The mutation results in a stop-codon substitution to a lysine residue and an increase of 21 amino-acids in the β-globin chain.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
Allele Phenotype: | N/A |
Stability: | Unstable |
Oxygen Affinity: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72016 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Nonsense codon (Translation) |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Dominant |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Valeria Rizzuto, Tamara T Koopmann, Adoración Blanco-Álvarez, Barbara Tazón-Vega, Amira Idrizovic, Cristina Díaz de Heredia, Rafael Del Orbe, Miriam Vara Pampliega, Pablo Velasco, David Beneitez, Gijs W E Santen, Quinten Waisfisz, Mariet Elting, Frans J W Smiers, Anne J de Pagter, Jean-Louis H Kerkhoffs, Cornelis L Harteveld, Maria Del Mar Mañú-Pereira, doi: 10.3389/fphys.2021.628236. eCollection 2021. Usefulness of NGS for Diagnosis of Dominant Beta-Thalassemia and Unstable Hemoglobinopathies in Five Clinical Cases, Frontiers in Physiology, 12(0), 0, 2021
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | L. Harteveld, Cornelis | 2020-11-11 | First report. |
Created on 2020-11-11 11:41:12,
Last reviewed on 2021-06-03 09:32:24 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-11-11 11:41:12 | The IthaGenes Curation Team | Created |
2 | 2020-11-11 11:55:31 | The IthaGenes Curation Team | Reviewed. Comment added. |
3 | 2021-06-03 09:29:25 | The IthaGenes Curation Team | Reviewed. Effect on gene corrected. Reference and link added. |
4 | 2021-06-03 09:32:24 | The IthaGenes Curation Team | Reviewed. Publication corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-30 12:06:09