
IthaID: 3705
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 72 (+C) | HGVS Name: | HBA2:c.217dup |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GACGCGCTGACCAACGCCGTGGCGC [-/C] ACGTGGACGACATGCCCAACGCGCTG (Strand: +)
Comments: Found in a heterozygous state in an individual from the Baoan Region in southern China.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34109 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Yu Y, Yang Z, Yu H, Sun R, Zhu Y, Guo F, High prevalence of thalassemia with a novel α-thalassemia mutationin in Baoan populations in Guangdong province, China., Eur J Obstet Gynecol Reprod Biol, 2020
Created on 2020-11-17 17:17:54,
Last reviewed on 2020-11-17 17:39:19 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.