IthaID: 3850



Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: N/A
Common Name: CD 3 CTG>TTG [Leu>Leu] HGVS Name: HBB:c.10C>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
ACCTCAAACAGACACCATGGTGCAT [C/T] TGACTCCTGAGGAGAAGTCTGCCGT (Strand: -)

Comments: Found in a newborn associated with Hb Constant Spring [IthaID: 418], presented with Hb 13.5 g/dL, RBC 4.09×10^12/L, MCV 106.4 fL and MCH 33 pg. Capillary electrophoresis shown the presence of Hb Bart’s 1.3% and HbA 24.7%, HbF 73.5%, HbA2 0.3% and Hb CS 0.2%.

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70604
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Li, Youqiong2021-09-14First report.
Created on 2021-09-17 12:09:44, Last reviewed on 2021-09-17 13:07:09 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.