IthaID: 3851
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 68 CTC>CTA [Leu>Leu] | HGVS Name: | HBB:c.207C>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAGGCTCATGGCAAGAAAGTGCT [C/A] GGTGCCTTTAGTGATGGCCTGGC (Strand: -)
Comments: Found in a 27-year-old female in association with the Hb New York [IthaID:1187] presented with Hb 11.0 g/dL, RBC 5.79×10^12/L, MCV 68.9 fL and MCH 20 pg. Capillary electrophoresis shown reduced level of HbA 60% and normal level of HbA2 2.9%. The mutation decreased the level of Hb New York (37.1%).
External Links
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70931 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Li, Youqiong | 2021-09-14 | First report. |
Created on 2021-09-17 13:05:06,
Last reviewed on 2021-09-17 13:06:29 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.