
IthaID: 3883
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | IVS I-1 G>C | HGVS Name: | HBD:c.92+1G>C |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AGTTGGTGGTGAGGCCCTGGGCAG [G>C] TTGGTATCAAGGTTATAAGAGAGG (Strand: -)
Comments: Found in a heterozygous state. This mutation likely activates a cryptic acceptor site (actttttctcagCT) at exon 2 (c.253) with a HSF score of 87.41. In this case, the reported mutation would produce an abnormal mRNA resulting in reduced HbA2 level. There may be some possibility that in IVS Ӏ-1 G>C, exon 1 joins directly to exon 3 by removing IVS Ӏ, exon 2, and IVS ӀӀ by splicing.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | δ-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 63275 |
| Size: | 1 bp |
| Located at: | δ |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Splice junction (mRNA Processing) |
| Ethnic Origin: | Tunisian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Kasmi C, Amri Y, Hadj-Fredj S, Oueslati S, Dabboussi M, Mahjoub R, Hammami S, Aljane I, Mami FB, Jamoussi H, Messaoud T, Bibi A, Analysis of δ-globin gene alleles in Tunisians: description of three new delta-thalassemia mutations., Mol Biol Rep, 48(8), 5923-5933, 2021
Created on 2021-12-29 15:38:15,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.