IthaID: 3920
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | -368 C>A | HGVS Name: | HBG1:c.-420C>A |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TTAAACTACAGGCCTCACTGGAG [C/A] TAGAGACAAGAAGGTAAAAAACG (Strand: -)
Also known as:
Comments: Found in a case in association with HBG1:c.-272_-275dup [IthaID:3865], presented with Hb 15.6 g/dL, MCV 85.2 fL and MCH 28.1 pg. Haemoglobin electrophoresis shown HbA 85.4%, HbA2 2.5% and HbF 11.6% and a small abnormal peak of 0.5% appears next to Hb A2.
External Links
Phenotype
Hemoglobinopathy Group: | HPFH |
---|---|
Hemoglobinopathy Subgroup: | HPFH |
Allele Phenotype: | N/A |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 47391 |
Size: | 1 bp |
Located at: | Aγ |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Promoter (Transcription) |
Ethnic Origin: | Han Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Zhuang, Qianmei | 2022-05-06 | First report. |
Created on 2022-05-09 13:06:24,
Last reviewed on (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2022-05-09 13:06:24 | The IthaGenes Curation Team | Created |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-06-30 11:49:51