IthaID: 3965

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 84-87 (-CTTTGCCACA) (+TTTTTCTCAG) HGVS Name: HBB:c.255_264delinsTTTTTCTCAG
Hb Name: Hb Wanjiang Protein Info: N/A
Also known as: Hb Donguan-Dongcheng

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCTGGACAACCTCAAGGGCAC [CTTTGCCACA/TTTTTCTCAG] CTGAGTGAGCTGCACTGTGAC (Strand: -)

Comments: Found in a male and his father presented with normal hematological features. The variant results from a 10 bp deletion at codons 84-87 of the β-globin chain, replaced with 10 nucleotides coming from the δ-globin gene at the same position, leading to the substitution of two amino acids in the peptide chain with no change in the β-globin chain length. The abnormal Hb variant was not detectable by CE and HPLC. Found in 8 healthy individuals from southern China during premarital/antenatal screening.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70979
Size: 10 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Wu SM, Jiang F, Li C, Guo ZT, Huang SR, Li DZ, Hb Wanjiang: A New β-Globin Chain Variant with Two Amino Acid Substitutions (: c.255_264delinsTTTTTCTCAG)., Hemoglobin, 2022
  2. Zhang Q, Wang G, Sun D, Lin W, Yan T, Wu Y, Wu M, Chen J, Zou S, Xie W, Zhou Y, Wang Y, He L, Liu Y, Qiu Z, Hu L, Lin B, Zhou X, Li Y, Xu X, MALDI-TOF-MS for Rapid Screening and Typing of β-Globin Variant and β-Thalassemia through Direct Measurements of Intact Globin Chains., Clin Chem, 2022
Created on 2022-09-07 08:44:28, Last reviewed on 2022-12-06 12:54:41 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.