IthaID: 4026


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 46 GGG>CGG [Gly>Arg], IVS II-456 A>G HGVS Name: HBD:c.[139G>C;316-443A>G]
Hb Name: Hb A2-Malay Protein Info: N/A

Context nucleotide sequence:
GGACCCAGAGGTTCTTTGAGTCCTTT [G>C] GGGATCTGTCCTCTCCTGATGCTGTT (Strand: -)

Also known as:

Comments: CD 46 G>C nucleotide substitution is found together with IVS II-456 A>G in six Malay individuals. One individual also carried Asian-Indian Inv/Del Gγ(Aγδβ)0 [IthaID: 1519]. It is hypothesized that CD 46 G>C and IVS II-456 A>G occur on the same allele since this individual carries a deletion on the other allele.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63449 or 64081
Size: 1 bp or 1 bp
Located at: δ
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Malay
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Syahzuwan, Hassan2023-05-25First report.
Created on 2023-05-26 10:54:26, Last reviewed on 2023-05-26 11:03:46 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.