IthaID: 4071
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 1 (-G) | HGVS Name: | HBA2:c.4del |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACAGACTCAGAGAGAACCCACCATG [G/-] TGCTGTCTCCTGCCGACAAGACCAA (Strand: +)
Comments: The c.4del (p.Val2fs) is a single nucleotide deletion variant in exon 1 of the HBA2 gene. It produces a truncated α-globin chain with a premature termination codon at position 48, leading to an α+-thalassemia phenotype. It was found in a 23-year-old Chinese male with mild microcytosis (Hb 15.7g/dL, MCV 77.9 fL, MCH 25.6 pg, RBC 6.14×10^12/L).
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33779 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Li W, Wei G, Ren S, Xie Z, Luo X, Zhang L, Huang Y, Yuan D, : C.4delG: A Novel Frameshift Mutation Causing α-Thalassemia Found in a Chinese Family., Hemoglobin, 2025
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Li, Wei | 2023-09-10 | First report. |
Created on 2023-09-27 16:39:56,
Last reviewed on 2025-07-24 08:28:11 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.