IthaID: 4085

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 132 (+T) HGVS Name: HBA2:c.398dup
Hb Name: Hb Balkh Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TCCCTGGACAAGTTCCTGGCTTCTGT [-/T] GAGCACCGTGCTGACCTCCAAATAC (Strand: +)

Comments: The c.398dup variant (CD 132 GTG>GTTG) [p.Val133fs] is a frameshift mutation in the HBA2 gene, co-inherited with the α⁺ deletional variant -α³.⁷ [IthaID: 300] in a 13-year-old boy from Balkh province, Afghanistan, who has been receiving transfusions since the age of 5. The duplication of 'T' at p.Val133 causes a frameshift, resulting in an elongated α-chain with an additional 30 amino acids (171 in total). The HGVS nomenclature was assigned based on the sequence information provided in the paper.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34432
Size: 1 bp
Located at: α2
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Afghan
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Tavassoli S, Chung JH, Panigrahi AR, Shahsavar A, Lal A, Singer ST, Hemoglobin Balkh, a Novel Mutation in Codon 132 of α2-Globin Gene [α132(H15) (+T) or :C.396dup (p.Val134fs)]: A Case Report and Insight into the Pathophysiology., Hemoglobin, 48(4), 280-284, 2024

Microattributions

A/AContributor(s)DateComments
1Tavassoli, Shabnam2023-11-29First report.
Created on 2023-12-04 15:18:20, Last reviewed on 2025-03-14 08:58:29 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.