IthaID: 4085
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 132 (+T) | HGVS Name: | HBA2:c.398dup |
| Hb Name: | Hb Balkh | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TCCCTGGACAAGTTCCTGGCTTCTGT [-/T] GAGCACCGTGCTGACCTCCAAATAC (Strand: +)
Comments: The c.398dup variant (CD 132 GTG>GTTG) is a frameshift variant in the HBA2 gene co-inherited with the α+ deletional variant -α3.7 [IthaID: 300] in a 13-year-old boy from Balkh province, Afghanistan, who has received transfusions since the age of 5 years. The duplication of 'T' at p.Val133 creates a frameshift with an additional 30 amino acids (171 amino acids in total), leading to an elongated α-chain.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34432 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Afghan |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Tavassoli S, Chung JH, Panigrahi AR, Shahsavar A, Lal A, Singer ST, Hemoglobin Balkh, a Novel Mutation in Codon 132 of α2-Globin Gene [α132(H15) (+T) or :C.396dup (p.Val134fs)]: A Case Report and Insight into the Pathophysiology., Hemoglobin, 48(4), 280-284, 2024
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Tavassoli, Shabnam | 2023-11-29 | First report. |
Created on 2023-12-04 15:18:20,
Last reviewed on 2024-12-03 11:48:06 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.