IthaID: 4111
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | Poly A (AATAAA>AAΑΑΑ) | HGVS Name: | HBA2:c.*91delT |
| Hb Name: | N/A | Protein Info: | α2 nt 816 delT |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCACCGGCCCTTCCTGGTCTTTGAA [T/-] AAAGTCTGAGTGGGCAGCAGCCTGTG (Strand: +)
Comments: Found as a novel mutation in a Chinese patient, in compound heterozygosity with –SEA [IthaID: 309], leading to severe non-deletional Hb H disease with blood transfusion dependence since infancy.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α+/α0 |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34554 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Poly(A) |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | RNA cleavage - Poly(A) signal (mRNA Processing) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Ren ZM, Li WJ, Xing ZH, Fu XY, Zhang JY, Chen YS, Li DF, Detecting rare thalassemia in children with anemia using third-generation sequencing., Hematology, 28(1), 2241226, 2023 PubMed
Created on 2024-10-23 15:23:06,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.